OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR199A2 Human qPCR Template Standard (MI0000281)

Be the first to review this product
SKU
HK300655
MIR199A2 (Human) qSTAR miRNA primer pairs + Copy number standard kit
  $410.00
2 Weeks*

Other products for "MIR199A2 or MIMAT0000231"

Specifications
Specifications
Product Data
Recommended Application Plasmid of exact quantity for transcript copy number calculation
Forward Sequence CCCAGTGTTCAGACTACCTG
Reverse Sequence GAACATGTCTGCGTATCTC
ACCN MIMAT0000231
Synonyms hsa-miR-199a-5p; MI0000281; MIMAT0000231; MIR199A2 hsa-mir-199a-2
Components 1 vial of lyophilized SybGREEN qPCR miRNA primer mix (1 nmol each primer, sufficient for 200 reactions), 1 vial lyophilized qPCR miRNA template standard: 50 X 10^7 copies (100 reactions)
Quality Control Each standard is generated using qSTAR miRNA primer pairs and sequence-verified prior to shipment
Storage The primer mix and template standard are stable for one year from date of shipping. Store at -20°C.
Shipping Blue Ice
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

MicroRNA-199a is induced in dystrophic muscle and affects WNT signaling, cell proliferation, and myogenic differentiation
Alexander, Kawahara, Motohashi et al
Cell Death Differ. (2013) 20 (9), 1194-208 DOI: 10.1038/cdd.2013.62
Cited by 147
AI Summary: OriGene contributed plasmids overexpressing either a non-targeting (scrambled) miRNA or human miR-199a-2, which were used to manipulate miR-199a-5p expression and study its effects on muscle cell proliferation and differentiation in this research.
Snippet: The asterisk demarcates the supershift (SS) band. FP, free probe. Full figure and legend (194 K ). ... 10. Plasmids. Plasmids overexpressing either a non-targeting (scrambled) miRNA or human miR-199a-2 were obtained commercially (Origene, Rockville, MD, USA).
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products