OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ripk3 Mouse qPCR Primer Pair (NM_019955)

Be the first to review this product
SKU
MP212533
qSTAR qPCR primer pairs against Mus musculus gene Ripk3
  $150.00
3 Days*

Frequently Bought Together (4)

TA306042 Rabbit Polyclonal RIP3 Antibody
100 ug
$640.00
NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
MR207783 Ripk3 (Myc-DDK-tagged) - Mouse receptor-interacting serine-threonine kinase 3 (Ripk3), transcript variant 2
10 ug
$686.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "Ripk3 or BC029210"

Specifications
Specifications
Product Data
Locus ID 56532
Forward Sequence GAAGACACGGCACTCCTTGGTA
Reverse Sequence CTTGAGGCAGTAGTTCTTGGTGG
ACCN BC029210, NM_019955, NM_019955.1, NM_019955.2, BF658559, BY206463, BY209344
UniProt ID Q9QZL0
Synonyms 2610528K09Rik; AW107945; Rip3
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Inhibition of MLKL Attenuates Necroptotic Cell Death in a Murine Cell Model of Ischaemia Injury
Baidya, Gautheron, Crawford et al
J Clin Med (2021) 10 (2) DOI: 10.3390/jcm10020212
Cited by 16
AI Summary: OriGene contributed pre-validated real-time PCR primer sets for genes such as Slc2a1 and Vegf, which were used to measure gene expression in the study investigating necroptotic cell death during ischaemic injury.
Snippet: osphate dehydrogenase (GAPDH), prostaglandin-endoperoxide synthase 2 (Ptgs2), messenger RNA (mRNA). jcm-10-00212-t001_Table 1 Table 1 Real time PCR primer sets. Pre-validated primer sequences from Origene (Rockville, MD, USA). GENE PRIMER SEQUENCE (5′ TO 3′) Slc2a1 Forward GCTTCTCCAACTGGACCTCAAAC Reverse ACGAGGAGCACCGTGAAGATGA Vegf Forward CTGCTGTAAC
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products