OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Myh6 Mouse qPCR Primer Pair (NM_010856)

Be the first to review this product
SKU
MP208568
qSTAR qPCR primer pairs against Mus musculus gene Myh6
  $150.00
3 Days*

Frequently Bought Together (3)

NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX. 4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
MR226784 Myh6 (Myc-DDK-tagged) - Mouse myosin, heavy polypeptide 6, cardiac muscle, alpha (Myh6), transcript variant 1 10 ug
$1,629.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "Myh6 or BC110700"

Specifications
Specifications
Product Data
Locus ID 17888
Forward Sequence GCTGGAAGATGAGTGCTCAGAG
Reverse Sequence CCAGCCATCTCCTCTGTTAGGT
ACCN BC110700, NM_010856, NM_010856.1, NM_010856.2, NM_010856.3, NM_010856.4, BC061145, BC090979, BC138027
UniProt ID Q02566
Synonyms A830009F23Rik; AA517445; alpha-MHC; Myhc-a; Myhca
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products