Csf2 Mouse qPCR Primer Pair (NM_009969)
$150.00
3 Days*
Specifications
| Product Data | |
| Locus ID | 12981 |
|---|---|
| Forward Sequence | AACCTCCTGGATGACATGCCTG |
| Reverse Sequence | AAATTGCCCCGTAGACCCTGCT |
| ACCN | BC116878, BC116880, NM_009969, NM_009969.1, NM_009969.2, NM_009969.3, NM_009969.4 |
| UniProt ID | P01587 |
| Synonyms | CSF; Csfgm; Gm-CSf; GMCSF; MGI-IGM |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Reviews
Documents
| Product Manuals |
| FAQs |
Resources
Citations
Aerobic Glycolysis Controls Myeloid-Derived Suppressor Cells and Tumor Immunity via a Specific CEBPB Isoform in Triple-Negative Breast Cancer
Li, Tanikawa, Kryczek et al
Cell Metab. (2018) 28 (1), 87-103.e6 DOI: 10.1016/j.cmet.2018.04.022
Li, Tanikawa, Kryczek et al
Cell Metab. (2018) 28 (1), 87-103.e6 DOI: 10.1016/j.cmet.2018.04.022
AI Summary: In this study, OriGene qPCR primers—including Mouse G-CSF (MP202847), Mouse GM-CSF (MP202843), Mouse LDHA (MP207257), Mouse ACTb (MP200232), Mouse IL-1b (MP206724), Mouse TGF-b (MP217184), Mouse CEBPB (MP201856), Mouse MMP9 (MP207904), Mouse LC3B (MP208170), Human LDHA (HP208683), Human GM-CSF (HP200702), and Human ACTB (HP204660)—were used to measure gene expression levels critical for investigating the molecular mechanisms linking glycolysis, myeloid-derived suppressor cells, and tumor immunity in triple-negative breast cancer.
Snippet: …However, the link between MDSCs and glycolysis.;Oligonucleotides Primers for colony This paper See Table S2 siRNA for mouse ULK1 Qiagen Cat# GS22241 siRNA for mouse FIP200 Qiagen Cat# GS12421 siRNA for mouse ATG5 Qiagen Cat# GS11793 siRNA for mouse LC3b Qiagen Cat# GS67443 Mouse G-CSF primer Origene Cat# MP202847 Mouse GM-CSF primer Origene Cat# MP202843 Mouse LDHA primer Origene Cat# MP207257 Mouse ACTb primer Origene Cat# MP200232 Mouse IL-1b primer Origene Cat# MP206724 Mouse TGF-b primer Origene Cat# MP217184 Mouse CEBPB primer Origene Cat# MP201856 Mouse MMP9 primer Origene Cat# MP207904 Mouse LC3B primer Origene Cat# MP208170 Human LDHA primer Origene Cat# HP208683 Human GM-CSF primer Origene Cat# HP200702 Human ACTB primer Origene Cat# HP204660
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
