OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Cxcr5 Mouse qPCR Primer Pair (NM_007551)

Be the first to review this product
SKU
MP202369
qSTAR qPCR primer pairs against Mus musculus gene Cxcr5
  $150.00
3 Days*

Frequently Bought Together (3)

NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
MR205790 Cxcr5 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) receptor 5 (Cxcr5)
10 ug
$289.00 $686.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "Cxcr5 or BC064059"

Specifications
Specifications
Product Data
Locus ID 12145
Forward Sequence ATCGTCCATGCTGTTCACGCCT
Reverse Sequence CAACCTTGGCAAAGAGGAGTTCC
ACCN BC064059, NM_007551, NM_007551.1, NM_007551.2
UniProt ID Q04683
Synonyms Blr1; CXC-R5; CXCR-5; Gpcr6; MDR15
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Genome-wide chromatin accessibility and transcriptome analysis reveal the up-regulation of immunosuppressive genes in macrophages under simulated microgravity
Wang, Zhang, Shi et al
Life Sciences in Space Research (2025) 45, 143-150 DOI: 10.1016/j.lssr.2025.03.002
Cited by 2
AI Summary: OriGene products contributed to this paper by providing gene-specific qRT-PCR primers (CD83 [MP201954], Cebpd [MP201857], Cxcr5 [MP202369], Dusp6 [MP203964], Tnfrsf22 [MP217763], Sema4b [MP215131]) used to measure the expression of candidate genes in macrophages under simulated microgravity.
Snippet: …The catalog number of the primers are as follow: CD83 (MP201954), Cebpd (MP201857), Cxcr5 (MP202369), Dusp6 (MP203964), Tnfrsf22 (MP217763), Sema4b (MP215131). …
Clostridioides difficile toxin B subverts germinal center and antibody recall responses by stimulating a drug-treatable CXCR4-dependent mechanism
Norman, Lang, Shadid et al
Cell Rep (2024) 43 (5), 114245 DOI: 10.1016/j.celrep.2024.114245
Cited by 13
AI Summary: OriGene’s Mouse qPCR Primer Pairs for Cxcr4 (Cat # MP202423), Cxcr5 (Cat # MP202369), Ccr7 (Cat # MP202402), and Gapdh (Cat # MP205604) were used in this study to quantify gene expression changes in B cells, helping to elucidate the molecular mechanisms by which C. difficile toxin B impairs immune memory responses.
Snippet: SuperScript III First-Strand Synthesis System for RT-PCR Invitrogen Cat # 18080-051 Cxcr4 Mouse qPCR Primer Pair OriGene Cat # MP202423 Cxcr5 Mouse qPCR Primer Pair OriGene Cat # MP202369 Ccr7 Mouse qPCR Primer Pair OriGene Cat # MP202402 Gapdh Mouse qPCR Primer Pair OriGene Cat # MP205604 Excalibur’s Alcoholic Z-Fix Excalibur Pathology N/A AMD3100 Millipore Sigma Cat # A5602
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products