OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SPAG17 Human qPCR Primer Pair (NM_206996)

Be the first to review this product
SKU
HP219614
qSTAR qPCR primer pairs against Homo sapiens gene SPAG17
  $150.00
5 Days*

Frequently Bought Together (3)

NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
RC213491 SPAG17 (Myc-DDK-tagged)-Human sperm associated antigen 17 (SPAG17)
10 ug
$1,834.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "SPAG17 or NM_206996"

Specifications
Specifications
Product Data
Locus ID 200162
Forward Sequence CCAGAGCCTAAATGTGTCTTGCC
Reverse Sequence GGTAGCTCTGACGGACCATGAT
ACCN NM_206996, NM_206996.2, NM_206996.3, BC043251, BC148427, BX648110, NM_206996.4
UniProt ID Q6Q759
Synonyms CT143; PF6; SPGF55
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Spag17 deficiency results in skeletal malformations and bone abnormalities
Teves, Sundaresan, Cohen et al
PLoS One (2015) 10 (5), e0125936 DOI: 10.1371/journal.pone.0125936
Cited by 40
AI Summary: OriGene’s Spag17 siRNA duplex (SR421841) was used to knock down Spag17 expression in wild-type mouse embryonic fibroblasts, helping to demonstrate that reduced Spag17 levels lead to shorter primary cilia, thus implicating Spag17 in skeletal growth and bone abnormalities.
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products