OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ATPase Inhibitory Factor 1 (ATPIF1) Human qPCR Primer Pair (NM_016311)

Be the first to review this product
SKU
HP212115
qSTAR qPCR primer pairs against Homo sapiens gene ATPIF1
  $150.00
3 Days*

Frequently Bought Together (3)

NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
RC201920 ATPIF1 (Myc-DDK-tagged)-Human ATPase inhibitory factor 1 (ATPIF1), nuclear gene encoding mitochondrial protein, transcript variant 1
10 ug
$225.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "ATP5IF1 or BC001867"

Specifications
Specifications
Product Data
Locus ID 93974
Forward Sequence GAGCAGGCTGAAGAGGAACGAT
Reverse Sequence CAGACGCTCAATCTCCTTCTTATG
ACCN BC001867, NM_016311, NM_016311.2, NM_016311.3, NM_016311.4, BC009677, BC009677.1, BC004955, BC017562, BG036978, BG337531, BG714388, BP271519, BT009849, NM_016311.5
UniProt ID Q9UII2
Synonyms ATPI; ATPIF1; ATPIP; IP
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

ATPIF1 maintains normal mitochondrial structure which is impaired by CCM3 deficiency in endothelial cells
Wang, Chen, Zhou et al
Cell Biosci (2021) 11 (1), 11 DOI: 10.1186/s13578-020-00514-z
Cited by 16
AI Summary: OriGene products contributed to this paper by providing gene-specific PCR primers (from https://www.OriGene.com/) used for quantitative real-time PCR analysis to measure gene expression changes associated with CCM3 deficiency and ATPIF1 overexpression in endothelial cells.
Snippet: using iScript cDNA Synthesis Kit (1,708,891, BIO-RAD). Real time PCR was performed with CFX-96 (BIO-RAD) using the iQ SYBR Green Supermix (1,708,882, BIO-RAD). Primers were inquired from https://www.origene.com/, and double checked by NCBI blast. All values were normalized with β-actin abundance. Data were presented as the average of triplicates ± SD. Western blotting HUVECs and EPCs were
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products