TNFAIP2 Human qPCR Primer Pair (NM_006291)
$150.00
5 Days*
Specifications
| Product Data | |
| Locus ID | 7127 |
|---|---|
| Forward Sequence | TGCTCCAGAACCTGCATGAGGA |
| Reverse Sequence | AACTCAGGCAGCCTCGTGTCTA |
| ACCN | NM_006291, NM_006291.1, NM_006291.2, BC017818, BC128449, BC128450, NM_006291.4 |
| UniProt ID | Q03169 |
| Synonyms | B94; EXOC3L3 |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Reviews
Documents
| Product Manuals |
| FAQs |
Resources
Citations
Targeting TNFAIP2 with NIR-II CRISPR-Cas9 nanosystem to overcome cisplatin resistance in laryngeal cancer
Li, Wang, Guo et al
NPJ Precis Oncol (2025) 9 (1), 263 DOI: 10.1038/s41698-025-01054-w
Li, Wang, Guo et al
NPJ Precis Oncol (2025) 9 (1), 263 DOI: 10.1038/s41698-025-01054-w
Cited by 2
AI Summary: OriGene’s Human TNFAIP2 qPCR Primer Pair (HP209262) and Human GAPDH qPCR Primer Pair (HP205798) were used to measure gene expression levels, helping to assess the impact of TNFAIP2 knockout on cisplatin resistance in laryngeal cancer cells.
Snippet: ). GAPDH served as the internal control. Relative gene expression was calculated using the 2-ΔΔCT method. The primer pairs used in this study included the Human TNFAIP2 qPCR Primer Pair (HP209262, Origene, USA) and the Human GAPDH qPCR Primer Pair (HP205798, Origene, USA). The sequences of these primers are detailed in Table S1. Western blot analysis Cells from each experimental group were harv
Combined inhibition of Ref-1 and STAT3 leads to synergistic tumour inhibition in multiple cancers using 3D and in vivo tumour co-culture models
Caston, Shah, Starcher et al
J Cell Mol Med (2020)
Caston, Shah, Starcher et al
J Cell Mol Med (2020)
AI Summary: OriGene contributed to this study by providing gene-specific primers used for qPCR analysis to assess gene expression changes following combined inhibition of Ref-1 and STAT3.
Snippet: Primers for indicated genes were purchased from OriGene
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
