OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

T Plastin (PLS3) Human qPCR Primer Pair (NM_005032)

Be the first to review this product
SKU
HP208248
qSTAR qPCR primer pairs against Homo sapiens gene PLS3
  $150.00
5 Days*

Frequently Bought Together (4)

TA350287 Rabbit Polyclonal Anti-PLS3 Antibody
100 ul
$205.00
NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
RC230333 PLS3 (Myc-DDK-tagged)-Human plastin 3 (PLS3), transcript variant 3
10 ug
$842.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "PLS3 or NM_005032"

Specifications
Specifications
Product Data
Locus ID 5358
Forward Sequence CCTCATCTGGTTTTGGGACTGC
Reverse Sequence CCTCCAAAGTCTCACCATCTCG
ACCN NM_005032, NM_005032.1, NM_005032.2, NM_005032.3, NM_005032.4, NM_005032.5, NM_005032.6, BC056898, BC056898.1, BC039049, BC008588, BC150494, BM979335, BP214207, NM_005032.7
UniProt ID P13797
Synonyms BMND18; T-plastin
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products