hCG (CGA) Human qPCR Primer Pair (NM_000735)
Specifications
| Product Data | |
| Locus ID | 1081 |
|---|---|
| Forward Sequence | TCCATTCCGCTCCTGATGTGCA |
| Reverse Sequence | CGTCTTCTTGGACCTTAGTGGAG |
| ACCN | NM_000735, NM_000735.1, NM_000735.2, NM_000735.3, BC010957, BC010957.1, BC020782, BC055080, BG571584, BG619154, NM_000735.4 |
| UniProt ID | P01215 |
| Synonyms | CG-ALPHA; FSHA; GPA1; GPHa; GPHA1; HCG; LHA; TSHA |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Reviews
Documents
| Product Manuals |
| FAQs |
Resources
Citations
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.