OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

IL8 (CXCL8) Human qPCR Primer Pair (NM_000584)

Be the first to review this product
SKU
HP200551
qSTAR qPCR primer pairs against Homo sapiens gene CXCL8
  $150.00
3 Days*

Frequently Bought Together (4)

TA600024 IL-8 mouse monoclonal capture antibody, validated for ELISA and Luminex assays
100 ug
$458.00
NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
RC202075 IL8 (Myc-DDK-tagged)-Human interleukin 8 (IL8)
10 ug
$150.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "CXCL8 or NM_000584"

Specifications
Specifications
Product Data
Locus ID 3576
Forward Sequence GAGAGTGATTGAGAGTGGACCAC
Reverse Sequence CACAACCCTCTGCACCCAGTTT
ACCN NM_000584, NM_000584.1, NM_000584.2, NM_000584.3, BC013615, BG497712, BT007067, NM_000584.4
UniProt ID P10145
Synonyms GCP-1; GCP1; IL8; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP-1; NAP1; SCYB8
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Promotion of Tumor Cell Senescence by the Antibody–Drug Conjugate, Sacituzumab Govitecan
Chakraborty, Sinanian, Rahman et al
Molecular Pharmacology (2026)
AI Summary: OriGene contributed qSTAR qPCR primers for IL-6 (HP200567), IL-8 (CXCL8, HP200551), IL-1β (HP200544), and GAPDH (HP205798), which were used to measure gene expression levels in this study.
Snippet: triplicates using Power Track SYBR Green Mastermix (Applied Biosystems;Waltham, MA, USA, A46109) on the QuantStudio 3 Real-Time PCR System. qSTAR qPCR primers were purchased from OriGene (Rockville, MD, USA): IL-6: HP200567;IL-8 (CXCL8): HP200551;IL-1β: HP200544;GAPDH: HP205798. Relative mRNA expression was determined using the ΔΔCt method
Cis-urocanic acid formation following far-UVC exposure and associated signaling responses in keratinocytes
Thomas, Hazell, Baczynska et al
Photochem Photobiol (2026)
AI Summary: OriGene contributed human IL-6 (#HP200567) and IL-8 (#HP200551) qPCR primer pairs, which were used to measure cytokine gene expression in keratinocytes following far-UVC and solar simulated radiation exposure.
Snippet: , #HP200567) gene expression and IL- 8 (Origene, #HP200551), human qPCR primer pairs were obtained from Origene. GAPDH was used as a housekeeping gene
Ameliorating effect of S-Allyl cysteine (Black Garlic) on 6-OHDA mediated neurotoxicity in SH-SY5Y cell line
Yeni, Cicek, Yildirim et al
Toxicol Rep (2024) 13, 101762 DOI: 10.1016/j.toxrep.2024.101762
Cited by 5
Snippet: ded at 450 nm using a microplate reader. 2.4 Determination of TNF-α, IL-1, and IL-8 expression levels To measure the expression levels of IL-1 (HP200544), IL-8 (HP200551), and TNF- α (HP200561) (Origene, USA) in cultured SY-SH5Y, we first extracted total RNA with the High Pure RNA Isolation kit (Roche, USA). Switzerland), then the Transcriptor First Strand cDNA Synthesis kit (Roche, Switzerla
FigureFigureFigure
A Simple and Efficient System for Producing Recombinant Human CXCL8 in Escherichia coli
Huang, Zhong, Park et al
J. Interferon Cytokine Res. (2020)
Cited by 2
AI Summary: OriGene’s full-length human CXCL8 plasmid was used as the PCR template to amplify CXCL8 cDNA for cloning and expression in the new recombinant protein production system described in the study.
Snippet: Cloning. Human CXCL8 cDNA (NCBI:NP_000575) was amplified by PCR from plasmid containing full-length human CXCL8 (Origene, MD, USA) and cloned into pASK75, with a C-terminal His 6 -tag and an N-terminal OmpA signal sequence for periplasmic secretion
Upregulation of CBP by PLY can cause permeability of blood-brain barrier to increase meningitis
Chen, Li, Wang et al
J. Biochem. Mol. Toxicol. (2019)
AI Summary: OriGene's qPCR Primer Pairs for CBP, p300, and IL-10 were used in this study to measure gene expression changes that helped elucidate how pneumolysin (PLY) increases blood-brain barrier permeability in pneumococcal meningitis.
Snippet: expression. The primers of IL‐6, IL‐8, and GAPDH were previously described and the primers of CBP, p300 as well as IL‐10 were from the available qPCR Primer Pairs of OriGene Technologies (Rockville, MD) (Table 1).8. Table
Midkine is up-regulated in both cancerous and inflamed bowel, reflecting lymph node metastasis in colorectal cancer and clinical activity of ulcerative colitis
Krzystek-Korpacka, Gorska, Diakowska et al
Cytokine (2016)
AI Summary: OriGene contributed to this paper by providing the primer sequences for RT-qPCR analysis of midkine expression, as referenced from OriGene (www.OriGene.com).
Snippet: R: actgagactaaggcagaaga. Amp., amplicon;E, efficiency. a Primer sequences wereas proposed by Origene (www.origene.com). The remaining primers were designed using BeaconDesigner Probe/Primer Design Software (BioRad) and validated in silico by Blast ... Cite SaveSaving
Showing 1-6 of 10 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products