OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MPP1 (NM_001166461) Human Untagged Clone

Be the first to review this product
SKU
SC328733
MPP1 (untagged)-Human membrane protein palmitoylated 1 55kDa (MPP1) transcript variant 3
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA366290 MPP1 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MPP1 or NM_001166461"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MPP1
Synonyms AAG12; DXS552E; EMP55; MRG1; PEMP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC328733 representing NM_001166461.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCCTCAAGGCGAGCGAGGGCGAGAGTGGGGGCAGCATGCACACGGCGCTCTCCGACCTCTACCTG
GAGCATTTGCTGCAGAAGCGTAGTCGGCCAGAGGCTGTATCGCATCCATTGAATACTGTGACCGAGGAC
ATGTACACCAACGGGTCTCCTGCCCCAGGTAGCCCTGCCCAGGTCAAGGGACAGGAGGTGCGGAAAGTG
CGACTCATACAGTTTGAGAAGGTCACAGAAGAGCCCATGGGAATCACGCTGAAGCTGAATGAAAAACAG
TCCTGTACGGTGGCCAGAATTCTTCATGGTGGCATGATCCATAGACAAGGCTCCCTTCACGTGGGGGAT
GAGATCCTAGAAATCAATGGCACAAATGTGACAAATCATTCAGTGGATCAGCTGCAGAAGGCGATGAAA
GAAACCAAAGGAATGATCTCATTAAAAGTAATTCCCAACCAGCAAAGCCGTCTTCCTGCACTACAGGAG
GCGGGACTGAAGTTTGCTACTGGGGACATTATCCAGATTATCAACAAGGATGACAGCAATTGGTGGCAG
GGACGGGTGGAAGGCTCCTCCAAGGAGTCAGCAGGATTGATCCCTTCCCCTGAGCTGCAGGAATGGCGA
GTGGCAAGTATGGCTCAGTCAGCTCCTAGCGAAGCCCCGAGCTGCAGTCCCTTTGGGAAGAAGAAGAAG
TACAAAGACAAATATCTGGCCAAGCACAGCTCGATTTTTGATCAGTTGGATGTTGTTTCCTACGAGGAA
GTCGTTCGGCTCCCTGCATTCAAGAGGAAGACCCTGGTGCTGATCGGAGCCAGTGGGGTGGGTCGCAGC
CACATTAAGAATGCCCTGCTCAGCCAGAATCCGGAGAAGTTTGTGTACCCTGTCCCATATACAACACGG
CCGCCAAGGAAGAGTGAGGAAGATGGGAAGGAGTACCACTTTATCTCAACGGAGGAGATGACGAGGAAC
ATCTCTGCCAATGAGTTCTTGGAGTTTGGCAGCTACCAAGGCAACATGTTTGGCACCAAATTTGAAACA
GTGCACCAGATCCATAAGCAGAACAAGATTGCCATCCTTGACATTGAGCCCCAGACCCTGAAAATTGTT
CGGACAGCAGAACTTTCGCCTTTCATTGTGTTCATTGCACCTACTGACCAGGGCACTCAGACAGAAGCC
CTGCAGCAGCTGCAGAAGGACTCTGAGGCCATCCGCAGCCAGTACGCTCACTACTTTGACCTCTCACTG
GTCAATAATGGTGTTGATGAAACCCTTAAGAAATTACAAGAAGCCTTCGACCAAGCGTGCAGTTCTCCA
CAGTGGGTGCCTGTCTCCTGGGTTTACTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001166461
Insert Size 1341 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001166461.1
RefSeq Size 2007 bp
RefSeq ORF 1341 bp
Locus ID 4354
UniProt ID Q00013
Cytogenetics Xq28
Protein Families Druggable Genome
MW 49.9 kDa
Summary This gene encodes the prototype of the membrane-associated guanylate kinase (MAGUK) family proteins. MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intercellular junctions. The encoded protein is an extensively palmitoylated membrane phosphoprotein containing a PDZ domain, a Src homology 3 (SH3) motif, and a guanylate kinase domain. This gene product interacts with various cytoskeletal proteins and cell junctional proteins in different tissue and cell types, and may be involved in the regulation of cell shape, hair cell development, neural patterning of the retina, and apico-basal polarity and tumor suppression pathways in non-erythroid cells. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Oct 2009
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the central coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001166461" in other vectors (4)
SKU Description Size Price
RC230095 MPP1 (Myc-DDK-tagged)-Human membrane protein, palmitoylated 1, 55kDa (MPP1), transcript variant 3 10 ug
$457.00
RC230095L3 Lenti ORF clone of Human membrane protein, palmitoylated 1, 55kDa (MPP1), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC230095L4 Lenti ORF clone of Human membrane protein, palmitoylated 1, 55kDa (MPP1), transcript variant 3, mGFP tagged 10 ug
$757.00
RG230095 MPP1 (tGFP-tagged) - Human membrane protein, palmitoylated 1, 55kDa (MPP1), transcript variant 3 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products