OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Cbl c (CBLC) (NM_001130852) Human Untagged Clone

Be the first to review this product
SKU
SC325915
CBLC (untagged)-Human Cas-Br-M (murine) ecotropic retroviral transforming sequence c (CBLC), transcript variant 2
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA505052 CBLC mouse monoclonal antibody, clone OTI3D9 (formerly 3D9) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Cbl c or NM_001130852"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Cbl c
Synonyms CBL-3; CBL-SL; RNF57
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC325915 representing NM_001130852.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTCTGGCGGTGGCCCCGTGGGGGCGACAGTGGGAAGAGGCCCGCGCCCTGGGCCGGGCAGTCAGG
ATGCTGCAGCGCCTAGAAGAGCAATGCGTCGACCCCCGGCTGTCCGTGAGTCCCCCTTCGCTGCGGGAC
CTGCTGCCCCGCACAGCGCAGCTGCTTCGAGAGGTGGCCCATTCTCGGCGGGCGGCCGGCGGAGGCGGC
CCCGGGGGTCCCGGCGGCTCTGGGGACTTTCTACTCATCTACCTGGCCAATCTGGAGGCCAAGAGCAGG
CAGGTGGCCGCGCTGCTGCCTCCCCGGGGCCGAAGGAGTGCCAACGACGAGCTCTTCCGGGCGGGCTCC
AGACTCAGGCGACAGCTGGCCAAGCTGGCCATCATCTTCAGCCACATGCACGCAGAGCTGCACGCACTC
TTCCCCGGGGGAAAGTACTGTGGACACATGTACCAGCTCACCAAGGCCCCCGCCCACACCTTCTGGAGG
GAAAGTTGCGGAGCCCGGTGTGTGCTGCCCTGGGCTGAGTTTGAGTCCCTCCTGGGCACCTGCCACCCT
GTGGAACCAGGCTGCACAGCCCTGGCCTTGCGCACCACCATTGACCTCACCTGCAGCGGGCACGTGTCC
ATCTTCGAGTTCGACGTCTTCACCAGGCTCTTTCAGCCATGGCCAACACTCCTCAAGAACTGGCAGCTC
CTGGCAGTCAACCACCCAGGCTACATGGCCTTCCTCACCTATGATGAGGTCCAAGAGCGTCTGCAGGCC
TGCAGGGACAAGCCAGGCAGCTACCTCTACCCAGATGGAAAGACCCACAACCCAGACCTGACTGAGCTC
GGCCAGGCAGAACCCCAGCAGCGCATCCACGTGTCAGAGGAGCAGCTGCAGCTCTACTGGGCCATGGAC
TCCACATTTGAGCTCTGCAAGATCTGTGCTGAGAGCAACAAGGATGTGAAGATTGAGCCGTGCGGGCAC
CTGCTCTGCAGCTGCTGCCTGGCTGCCTGGCAGCACTCGGACAGCCAGACCTGCCCCTTCTGCCGCTGC
GAGATCAAGGGCTGGGAGGCCGTGAGTATCTACCAGTTCCACGGTCAGGCTACTGCTGAGGACTCAGGG
AACAGCAGTGACCAGGAAGGCAGGGAGTTGGAGCTGGGGCAGGTGCCCCTTTCGGCTCCTCCATTGCCC
CCACGGCCAGATCTGCCCCCCAGGAAGCCCAGAAATGCCCAGCCGAAAGTGAGACTCCTAAAGGGGAAC
TCCCCTCCAGCTGCGCTGGGACCCCAGGACCCTGCCCCGGCCTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001130852
Insert Size 1287 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001130852.1
RefSeq Size 1453 bp
RefSeq ORF 1287 bp
Locus ID 23624
UniProt ID Q9ULV8
Cytogenetics 19q13.32
Protein Families Druggable Genome
Protein Pathways Chronic myeloid leukemia, Endocytosis, ErbB signaling pathway, Insulin signaling pathway, Jak-STAT signaling pathway, Pathways in cancer, T cell receptor signaling pathway, Ubiquitin mediated proteolysis
MW 47.4 kDa
Summary This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. provided by RefSeq, Feb 2012
Transcript Variant: This variant (2) omits an in-frame coding exon compared to variant 1, resulting in a shorter protein (isoform 2).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001130852" in other vectors (4)
SKU Description Size Price
RC225700 CBLC (Myc-DDK-tagged)-Human Cas-Br-M (murine) ecotropic retroviral transforming sequence c (CBLC), transcript variant 2 10 ug
$457.00
RC225700L3 Lenti ORF clone of Human Cas-Br-M (murine) ecotropic retroviral transforming sequence c (CBLC), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC225700L4 Lenti ORF clone of Human Cas-Br-M (murine) ecotropic retroviral transforming sequence c (CBLC), transcript variant 2, mGFP tagged 10 ug
$757.00
RG225700 CBLC (tGFP-tagged) - Human Cas-Br-M (murine) ecotropic retroviral transforming sequence c (CBLC), transcript variant 2 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products