OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

EVI2A (NM_014210) Human Untagged Clone

Be the first to review this product
SKU
SC324308
EVI2A (untagged)-Human ecotropic viral integration site 2A (EVI2A), transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA334296 Rabbit Polyclonal Anti-EVI2A Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "EVI2A or NM_014210"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol EVI2A
Synonyms EVDA; EVI-2A; EVI2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_014210.2 CTAGCTGCACATATCCTTTTTTACTGCAGATTTACTTTAAGGCTCATATTCTCCAAGTCT
ATTCTGCTTTAAAAAGAAGACAAGAAAAGAAGTGGTTTATCAAAATCACGTTATAATCAG
ATTTTGACCAAGCATTTTGTAAGATTGCCAAGCATGCCCACGGACATGGAACACACAGGA
CATTACCTACATCTTGCCTTTCTGATGACAACAGTTTTTTCTTTGTCTCCTGGAACAAAA
GCAAACTATACCCGTCTGTGGGCTAACAGTACTTCTTCCTGGGATTCAGTTATTCAAAAC
AAGACAGGCAGAAACCAAAATGAAAACATTAACACAAACCCTATAACTCCTGAAGTAGAT
TATAAAGGTAATTCTACAAACATGCCTGAAACATCTCACATCGTAGCTTTAACTTCTAAA
TCTGAACAGGAGCTTTATATACCTTCTGTCGTCAGCAACAGTCCTTCAACAGTACAGAGC
ATTGAAAACACAAGCAAAAGTCATGGTGAAATTTTCAAAAAGGATGTCTGTGCGGAAAAC
AACAACAACATGGCTATGCTAATTTGCTTAATTATAATTGCAGTGCTTTTTCTTATCTGT
ACCTTTCTATTTCTATCAACTGTGGTTTTGGCAAACAAAGTCTCTTCTCTCAGACGATCA
AAACAAGTAGGCAAGCGTCAGCCTAGAAGCAATGGCGATTTTCTGGCAAGCGGTCTATGG
CCCGCTGAATCAGACACTTGGAAAAGAACAAAACAGCTCACAGGACCCAACCTAGTGATG
CAATCTACTGGAGTGCTCACAGCTACAAGGGAAAGAAAAGATGAAGAAGGAACTGAAAAA
CTTACTAACAAACAGATAGGTTAGTGAAGAAAAATGCAAAGTAGCAATGAGAAGGCTTAT
GGAGTAAAAATGAAGTCAGTTGGTATTTAATCCCAAAGTGTTGTTCTGATTATCTAAAAT
TTGACATGGTAGACCTTGCAATTTAGAATCAAGCAGGTGAGACAGGGAGAAGTATGCCTG
CTTAATTATTTAAACTGTGTACTTTTGTTTTGACACTGAATATTTTAAAAAGCAAATAAT
AAAATAACTAAGCATTTGAGGAAAATTTTAAGGATAAATTGAGGAAACTGATTAATAGAG
ATAGCAAGGGATAATTAAATAAATATTCCCTATGTAGCAACAGTGGTTAGATGATCTTTG
TCTGAATGTAATTAAACTTTGAATAGTTTTAGTGTGTCCTTAAAGCCAAGTATATGCTTT
AACATCAAATGGAAGTCAAATTCCTAATGCATAGATAGAGAGAGCTAAACTGTGTAATTT
AATGGTATCTTCCTTGCTGGATGTGGCAGAATCCACACCAGCTTATCAACCAACACAGCT
AATTTTAGAATAGATCCTTTATCTTTCCATATGGCACACGTAAGAAAGTGTTTTTCTACT
ATTAATATTAAATTAAAACCTTTACTTTTGTATAATAAATTAAAACTCAGAATAAACCTG
TGACCACGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_014210
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014210.2, NP_055025.2
RefSeq Size 1622 bp
RefSeq ORF 711 bp
Locus ID 2123
UniProt ID P22794
Cytogenetics 17q11.2
Protein Families Druggable Genome, Transmembrane
Summary May complex with itself or/and other proteins within the membrane, to function as part of a cell-surface receptor.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) lacks a portion of the 5' UTR and 5' coding region, and uses a downstream translational start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS representation uses the 5'-most in-frame start codon, which is conserved in higher primates. An alternative downstream start codon, which is more widely conserved and has a stronger Kozak signal, also exists. It is possible that leaky scanning by ribosomes would allow the downstream start codon to be used, at least some of the time. The use of the downstream start codon would result in a protein that is 4 aa shorter at the N-terminus. Both the longer and shorter N-termini have predicted signal peptides according to SignalP 3.0. There is no experimental evidence showing which start codon is preferentially used in vivo.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_014210" in other vectors (5)
SKU Description Size Price
RC207538 EVI2A (Myc-DDK-tagged)-Human ecotropic viral integration site 2A (EVI2A), transcript variant 2 10 ug
$300.00
RC207538L3 Lenti ORF clone of Human ecotropic viral integration site 2A (EVI2A), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC207538L4 Lenti ORF clone of Human ecotropic viral integration site 2A (EVI2A), transcript variant 2, mGFP tagged 10 ug
$600.00
RG207538 EVI2A (tGFP-tagged) - Human ecotropic viral integration site 2A (EVI2A), transcript variant 2 10 ug
$489.00 $500.00
SC115133 EVI2A (untagged)-Human ecotropic viral integration site 2A (EVI2A), transcript variant 2 10 ug
$300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products