OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SURF4 (NM_033161) Human Untagged Clone

Be the first to review this product
SKU
SC322772
SURF4 (untagged)-Human surfeit 4 (SURF4)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SURF4 or NM_033161"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SURF4
Synonyms ERV29
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_033161, the custom clone sequence may differ by one or more nucleotides


ATGGGCCAGAACGACCTGATGGGCACGGCCGAGGACTTCGCCGACCAGTTCCTCCGTGTCACAAAGCAGT
ACCTGCCCCACGTGGCGCGCCTCTGTCTGATCAGCACCTTCCTGGAGGACGGCATCCGTATGTGGTTCCA
GTGGAGCGAGCAGCGCGACTACATCGACACCACCTGGAACTGCGGCTACCTGCTGGCCTCGTCCTTCGTC
TTCCTCAACTTGCTGGGACAGCTGACTGGCTGCGTCCTGGTGTTGAGCAGGAACTTCGTGCAGTACGCCT
GCTTCGGGCTCTTTGGAATCATAGCTCTGCAGACGATTGCCTACAGCATTTTATGGGACTTGAAGTTTTT
GATGAGGAACCTGGCCCTGGGAGGAGGCCTGTTGCTGCTCCTAGCAGAATCCCGTTCTGAAGGGAAGAGC
ATGTTTGCGGGCGTCCCCACCATGCGTGAGAGCTCCCCCAAACAGTACATGCAGCTCGGAGGCAGGGTCT
TGCTGGTTCTGATGTTCATGACCCTCCTTCACTTTGACGCCAGCTTCTTTTCTATTGTCCAGAACATCGT
GGGCACAGCTCTGATGATTTTAGTGGCCATTGGTTTTAAAACCAAGCTGGCTGCTTTGACTCTTGTTGTG
TGGCTCTTTGCCATCAACGTATATTTCAACGCCTTCTGGACCATTCCAGTCTACAAGCCCATGCATGACT
TCCTGAAATACGACTTCTTCCAGACCATGTCGGTGATTGGGGGCTTGCTCCTGGTGGTGGCCCTGGGCCC
TGGGGGTGTCTCCATGGATGAGAAGAAGAAGGAGTGGTAA
Restriction Sites Please inquire |
ACCN NM_033161
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_033161.2, NP_149351.1
RefSeq Size 2985 bp
RefSeq ORF 810 bp
Locus ID 6836
UniProt ID O15260
Cytogenetics 9q34.2
Domains SURF4
Protein Families Transmembrane
Summary This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein that interacts with endoplasmic reticulum-Golgi intermediate compartment proteins. Disruption of this gene results in reduced numbers of endoplasmic reticulum-Golgi intermediate compartment clusters and redistribution of coat protein I to the cytosol. Alternate splicing results in multiple transcript variants. provided by RefSeq, Jul 2013
Transcript Variant: This variant (1) encodes the longest isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_033161" in other vectors (7)
SKU Description Size Price
RC210315 SURF4 (Myc-DDK-tagged)-Human surfeit 4 (SURF4) 10 ug
$300.00
RC210315L1 Lenti ORF clone of Human surfeit 4 (SURF4), Myc-DDK-tagged 10 ug
$600.00
RC210315L2 Lenti ORF clone of Human surfeit 4 (SURF4), mGFP tagged 10 ug
$600.00
RC210315L3 Lenti ORF clone of Human surfeit 4 (SURF4), Myc-DDK-tagged 10 ug
$600.00
RC210315L4 Lenti ORF clone of Human surfeit 4 (SURF4), mGFP tagged 10 ug
$600.00
RG210315 SURF4 (tGFP-tagged) - Human surfeit 4 (SURF4) 10 ug
$489.00 $500.00
SC128236 SURF4 (untagged)-Human surfeit 4 (SURF4) 10 ug
$300.00

file-alt Citations

A defect in COPI-mediated transport of STING causes immune dysregulation in COPA syndrome
Deng, Chong, Law et al
bioRxiv (2020)
Cited by 21
Snippet: Page 1. 1 Title: A defect in COPI-mediated transport of STING causes immune 1 dysregulation in COPA syndrome 2 3 Authors: Zimu Deng1 , Zhenlu Chong1 , Christopher S. Law1, Kojiro Mukai2,Frances O. Ho1, 4 Tereza Martinu3;Human STING and SURF4 were subcloned from HEK293T cDNA into pCMV6-AC 356 (Origene) with a FLAG tag at the C-terminus or a HA tag at the N-terminus, respectively. …
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products