OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

RBM3 (NM_006743) Human Untagged Clone

Be the first to review this product
SKU
SC322227
RBM3 (untagged)-Human RNA binding motif (RNP1, RRM) protein 3 (RBM3)
  $150.00
5 Days*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA380780 RBM3 Rabbit polyclonal Antibody
100 ul
$410.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "RBM3 or NM_006743"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RBM3
Synonyms IS1-RNPL; RNPL
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322227 GCTCCTCCGAGCTCGCTGTTCGTCCGGGTTTTTTACGTTTTAATTTCCAGGACTTGAACT
GCCATGTCCTCTGAAGAAGGAAAGCTCTTCGTGGGAGGGCTCAACTTTAACACCGACGAG
CAGGCACTGGAAGACCACTTCAGCAGTTTCGGACCTATCTCTGAGGTGGTCGTTGTCAAG
GACCGGGAGACTCAGCGGTCCAGGGGTTTTGGTTTCATCACCTTCACCAACCCAGAGCAT
GCTTCAGTTGCCATGAGAGCCATGAACGGAGAGTCTCTGGATGGTCGTCAGATCCGTGTG
GATCATGCAGGCAAGTCTGCTCGGGGAACCAGAGGAGGTGGCTTTGGGGCCCATGGGCGT
GGTCGCAGCTACTCTAGAGGTGGTGGGGACCAGGGCTATGGGAGTGGCAGGTATTATGAC
AGTCGACCTGGAGGGTATGGATATGGATATGGACGTTCCAGAGACTATAATGGCAGAAAC
CAGGGTGGTTATGACCGCTACTCAGGAGGAAATTACAGAGACAATTATGACAACTGAAAT
GAGACATGCACATAATATAGATACACAAGGAATAATTTCTGATCCAGGATCGTCCTTCCA
AATGGCTGTATTTATAAAGGTTTTTGGAGCTGCACTGAAGCATCTTATTTTATAGTATAT
CAACCTTTTGTTTTTAAATTGACCTGCCAAGGTAGCTGAAGACCTTTTAGACAGTTCCAT
CTTTTTTTTTAAATTTTTTCTGCCTATTTAAAGACAAATTATGGGACGTTTGTAGAACCT
GAGTATTTTTCTTTTTACCAGTTTTTTAGTTTGAGCTCTTAGGTTTATTGGAGCTAGCAA
TAATTGGTTCTGGCAAGTTTGGCCAGACTGACTTCAAAAAATTAATGTGTATCCAGGGAC
ATTTTAAAAACCTGTACACAGTGTTTATTGTGGTTAGGAAGCAATTTCCCAATGTACCTA
TAAGAAATGTGCATCAAGCCAGCCTGACCAACATGGTGAAACCCCATCTGTACTAAACAT
AAAAAAATTAGCCTGGCATGGTGGTGTACGCCTGTAATCCCAGTGACTTGGGAGGCTGAG
GCAGGAGAATCGCTTGAACCCGGGAGGCGGAGGTTGCAGTGAGCTAAGATCGCGCCACTG
TACTCCAGCCTGGGCAACAGCGAGACTCCATCTCAAAAAAAAAGGAAATGTGTATCAAGA
ACATGATTATCCAGGGGTATTTTCTAATTCAGATCATCAAACTGATTATATAGAAGAGTT
GGCTTTAAAATGTTTGCAAATGTCTTTTTTTTTTTAATACTGGAAGAAAAAATATTCTGT
TGTGTCTCATACAGTGCTTAGGATGTCTTTCACAGAGCTTATTAAAAAGATGAAACCTGA
AAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_006743
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006743.3, NP_006734.1
RefSeq Size 1588 bp
RefSeq ORF 474 bp
Locus ID 5935
UniProt ID P98179, A0A024QYX3
Cytogenetics Xp11.23
Domains RRM
Summary This gene is a member of the glycine-rich RNA-binding protein family and encodes a protein with one RNA recognition motif (RRM) domain. Expression of this gene is induced by cold shock and low oxygen tension. A pseudogene exists on chromosome 1. Multiple alternatively spliced transcript variants that are predicted to encode different isoforms have been characterized although some of these variants fit nonsense-mediated decay (NMD) criteria. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) encodes the longest isoform (a).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_006743" in other vectors (6)
SKU Description Size Price
RC201659 RBM3 (Myc-DDK-tagged)-Human RNA binding motif (RNP1, RRM) protein 3 (RBM3) 10 ug
$150.00
RC201659L1 Lenti ORF clone of Human RNA binding motif (RNP1, RRM) protein 3 (RBM3), Myc-DDK-tagged 10 ug
$450.00
RC201659L2 Lenti ORF clone of Human RNA binding motif (RNP1, RRM) protein 3 (RBM3), mGFP tagged 10 ug
$450.00
RC201659L3 Lenti ORF clone of Human RNA binding motif (RNP1, RRM) protein 3 (RBM3), Myc-DDK-tagged 10 ug
$450.00
RC201659L4 Lenti ORF clone of Human RNA binding motif (RNP1, RRM) protein 3 (RBM3), mGFP tagged 10 ug
$450.00
RG201659 RBM3 (tGFP-tagged) - Human RNA binding motif (RNP1, RRM) protein 3 (RBM3) 10 ug
$489.00

file-alt Citations

Alternative 3'UTR expression induced by T cell activation is regulated in a temporal and signal dependent manner
Blake, Gazzara, Breuer et al
Sci Rep (2024) 14 (1), 10987 DOI: 10.1038/s41598-024-61951-1
Cited by 6
AI Summary: OriGene's RBM3 cDNA plasmid (cat # SC322227) was used to overexpress RBM3 in 293T cells, enabling the study of its role in regulating alternative polyadenylation during T cell activation.
Snippet: A plasmid with the RBM3 cDNA driven from the CMV promoter was purchased from Origene (cat # SC322227) and transfected into 293T cells using Lipofectamine 2000 (;CGATGACGATATTCGCGCTCTC CPSF7_F: GAAAGGTCACCTAGCCGGTCCCG CPSF7_R: CGTTCTCTATCCCGGTGTCTCTCATG Transfection of 293T cells A plasmid with the RBM3 cDNA driven from the CMV promoter was purchased from Origene (cat # SC322227) and transfected into 293T cells using Lipofectamine 2000 (Thermo Fisher) according to the manufacturer’s protocol. …
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products