OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MRPL15 (NM_014175) Human Untagged Clone

Be the first to review this product
SKU
SC322219
MRPL15 (untagged)-Human mitochondrial ribosomal protein L15 (MRPL15), nuclear gene encoding mitochondrial protein
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA807480 MRPL15 mouse monoclonal antibody,clone OTI10B10 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MRPL15 or NM_014175"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MRPL15
Synonyms HSPC145; L15mt; MRP-L7; MRP-L15; RPML7
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322219 CCCGAGACCACGTGGCCTCCGAGCAGCTCAGGGCGCCCTTGAAAGTTCTTGGATCTGCGG
GTTATGGCCGGTCCCTTGCAGGGCGGTGGGGCCCGGGCCCTGGACCTACTCCGGGGCCTG
CCGCGTGTGAGCCTGGCCAACTTAAAGCCGAATCCCGGCTCCAAGAAACCGGAGAGAAGA
CCAAGAGGTCGGAGAAGAGGTAGAAAATGTGGCAGAGGCCATAAAGGAGAAAGGCAAAGA
GGAACCCGGCCCCGCTTGGGCTTTGAGGGAGGCCAGACTCCATTTTACATCCGAATCCCA
AAATACGGGTTTAACGAAGGACATAGTTTCAGACGCCAGTATAAGCCTTTGAGTCTCAAT
AGACTGCAGTATCTTATTGATTTGGGTCGTGTTGATCCTAGTCAACCTATTGACTTAACC
CAGCTTGTCAATGGGAGAGGTGTGACCATCCAGCCACTTAAAAGGGATTATGGTGTCCAG
CTGGTTGAGGAGGGTGCTGACACCTTTACGGCAAAAGTTAATATTGAAGTACAGTTGGCT
TCAGAACTAGCTATTGCTGCCATTGAAAAAAATGGTGGTGTTGTTACTACAGCCTTCTAT
GATCCAAGAAGTCTGGACATTGTATGCAAACCTGTTCCATTCTTTCTTCGTGGACAACCC
ATTCCAAAAAGAATGCTTCCACCAGAAGAACTGGTACCATATTACACTGATGCAAAGAAC
CGTGGGTACCTGGCGGATCCTGCCAAATTTCCTGAAGCACGACTTGAACTCGCCAGGAAG
TATGGTTATATCTTACCTGATATCACTAAAGATGAACTCTTCAAAATGCTCTGTACTAGG
AAGGATCCAAGGCAGATTTTCTTTGGTCTTGCTCCAGGATGGGTGGTGAATATGGCCGAT
AAGAAAATCCTAAAACCTACAGATGAAAATCTCCTTAAGTATTATACCTCATGAATTCCC
GTCCAAGGAAGCAGAGTTGTTAAAGAGTACTGGAATAGGGGCTGAAGGATCTATATTCCC
TTATTGCATTTTCCTTATGTATAATTTTCCAGATGGTGATGTTACTTTTCAGTGTACTCA
TATGTCTCATTTTCATCTAAAATTAAATGGCAGGAAACAAGGACTGCATAGTGAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_014175
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014175.2, NP_054894.1
RefSeq Size 1155 bp
RefSeq ORF 891 bp
Locus ID 29088
UniProt ID Q9P015
Cytogenetics 8q11.23
Domains L15
Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the EcoL15 ribosomal protein family. A pseudogene corresponding to this gene is found on chromosome 15q. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_014175" in other vectors (7)
SKU Description Size Price
RC201471 MRPL15 (Myc-DDK-tagged)-Human mitochondrial ribosomal protein L15 (MRPL15), nuclear gene encoding mitochondrial protein 10 ug
$300.00
RC201471L1 Lenti ORF clone of Human mitochondrial ribosomal protein L15 (MRPL15), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$600.00
RC201471L2 Lenti ORF clone of Human mitochondrial ribosomal protein L15 (MRPL15), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$600.00
RC201471L3 Lenti ORF clone of Human mitochondrial ribosomal protein L15 (MRPL15), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$600.00
RC201471L4 Lenti ORF clone of Human mitochondrial ribosomal protein L15 (MRPL15), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$600.00
RG201471 MRPL15 (tGFP-tagged) - Human mitochondrial ribosomal protein L15 (MRPL15), nuclear gene encoding mitochondrial protein 10 ug
$489.00 $500.00
SC111250 MRPL15 (untagged)-Human mitochondrial ribosomal protein L15 (MRPL15), nuclear gene encoding mitochondrial protein 10 ug
$300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products