OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SERPINB8 (NM_001031848) Human Untagged Clone

Be the first to review this product
SKU
SC321661
SERPINB8 (untagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 3
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA810530 SERPINB8 mouse monoclonal antibody,clone OTI8F10 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SERPINB8 or NM_001031848"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SERPINB8
Synonyms C18orf53; CAP2; PI-8; PI8; PSS5
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001031848.1 GTCAAAGCAGCAGCGGCGGCGGCGGCGGCGGCAGCAGCAGCAGCAGCAGGAGACCTTCTC
TGATGGATGACCTCTGTGAAGCAAATGGCACTTTTGCCATCAGCTTATTTAAAATATTGG
GGGAAGAGGACAACTCAAGAAACGTATTCTTCTCTCCCATGAGCATCTCCTCTGCCCTGG
CCATGGTCTTCATGGGGGCAAAGGGAAGCACTGCAGCCCAGATGTCCCAGGCACTTTGTT
TATACAAAGACGGAGATATTCACCGAGGTTTCCAGTCACTTCTCAGTGAAGTTAACAGAA
CTGGCACTCAGTACTTGCTTAGAACTGCCAACAGACTCTTTGGAGAAAAGACGTGTGATT
TCCTTCCAGACTTTAAAGAATACTGTCAGAAGTTCTATCAGGCAGAGCTGGAGGAGTTGT
CCTTTGCTGAAGACACTGAAGAGTGCAGGAAGCATATAAATGACTGGGTGGCAGAGAAGA
CTGAAGGTAAGATTTCAGAGGTACTGGATGCTGGGACAGTCGATCCCCTGACAAAGCTAG
TCCTTGTGAATGCCATTTATTTCAAGGGAAAGTGGAATGAGCAATTTGACAGAAAGTACA
CAAGGGGAATGCTCTTTAAAACCAACGAGGAAAAAAAGACAGTGCAGATGATGTTTAAGG
AAGCTAAGTTTAAAATGGGGTATGCGGATGAGGTACACACCCAGGTCCTGGAGCTGCCCT
ATGTGGAAGAGGAGCTGAGCATGGTCATTCTGCTTCCCGATGACAACACGGACCTCGCCG
TGAAAGAGTGATGGATCTTGAAGAATTTGAAGCTAACTCCAGGACAGGCAGAGGACAAAC
AAGGATGCTGATGAAGTCTTCTTGCATTCCCCATTTCTCGTCTCATGCTCCCTTCTCATG
CCTCCCTTCATCTTCAGATGAAACACAATTCCCTCTCTTTTACTCTGAGTTGCCCTCTGA
TTTAACCCTGAATAGTCCCCTCATTAGACTCAGAAGCAGAGTTCTGAGCCATGCTCTTTG
TCTTTTGTCAAACAATCTCTCCCACTCACAGTAGTATGTATTGCATGAAGATTAATGTAA
TGAATTGGTTAGAATTTTCTAAACTGTTAAAAAATGTTTTTAACATTTGAAAGGAGTTAG
GTACAAATTGTTTTTATTAAAAATTTCTGCCTGTCTCAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_001031848
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001031848.1, NP_001027018.1
RefSeq Size 1409 bp
RefSeq ORF 729 bp
Locus ID 5271
UniProt ID P50452
Cytogenetics 18q22.1
Protein Families Druggable Genome
Summary The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. provided by RefSeq, Jan 2017
Transcript Variant: This variant (3) uses an alternate splice junction in the 5' UTR and has an alternate 3'-most exon compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001031848" in other vectors (4)
SKU Description Size Price
RC205135 SERPINB8 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 3 10 ug
$300.00
RC205135L3 Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC205135L4 Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 3, mGFP tagged 10 ug
$600.00
RG205135 SERPINB8 (tGFP-tagged) - Human serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 3 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products