Sumo 1 (SUMO1) (NM_003352) Human Untagged Clone

SKU
SC321415
SUMO1 (untagged)-Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Sumo 1
Synonyms DAP1; GMP1; OFC10; PIC1; SENP2; SMT3; SMT3C; SMT3H3; UBL1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003352.4 CGTAGCGGAAGTTACTGCAGCCGCGGTGTTGTGCTGTGGGGAAGGGAGAAGGATTTGTAA
ACCCCGGAGCGAGGTTCTGCTTACCCGAGGCCGCTGCTGTGCGGAGACCCCCGGGTGAAG
CCACCGTCATCATGTCTGACCAGGAGGCAAAACCTTCAACTGAGGACTTGGGGGATAAGA
AGGAAGGTGAATATATTAAACTCAAAGTCATTGGACAGGATAGCAGTGAGATTCACTTCA
AAGTGAAAATGACAACACATCTCAAGAAACTCAAAGAATCATACTGTCAAAGACAGGGTG
TTCCAATGAATTCACTCAGGTTTCTCTTTGAGGGTCAGAGAATTGCTGATAATCATACTC
CAAAAGAACTGGGAATGGAGGAAGAAGATGTGATTGAAGTTTATCAGGAACAAACGGGGG
GTCATTCAACAGTTTAGATATTCTTTTTATTTTTTTTTCTTTTCCCTCAATCCTTTTTTA
TTTTTAAAAATAGTTCTTTTGTAATGTGGTGTTCAAAACGGAATTGAAAACTGGCACCCC
ATCTCTTTGAAACATCTGGTAATTTGAATTCTAGTGCTCATTATTCATTATTGTTTGTTT
TCATTGTGCTGATTTTTGGTGATCAAGCCTCAGTCCCCTTCATATTACCCTCTCCTTTTT
AAAAATTACGTGTGCACAGAGAGGTCACCTTTTTCAGGACATTGCATTTTCAGGCTTGTG
GTGATAAATAAGATCGACCAATGCAAGTGTTCATAATGACTTTCCAATTGGCCCTGATGT
TCTAGCATGTGATTACTTCACTCCTGGACTGTGACTTTCAGTGGGAGATGGAAGTTTTTC
AGAGAACTGAACTGTGGAAAAATGACCTTTCCTTAACTTGAAGCTACTTTTAAAATTTGA
GGGTCTGGACCAAAAGAAGAGGAATATCAGGTTGAAGTCAAGATGACAGATAAGGTGAGA
GTAATGACTAACTCCAAAGATGGCTTCACTGAAGAAAAGGCATTTTAAGATTTTTTAAAA
ATCTTGTCAGAAGATCCCAGAAAAGTTCTAATTTTCATTAGCAATTAATAAAGCTATACA
TGCAGAAATGAATACAACAGAACACTGCTCTTTTTGATTTTATTTGTACTTTTTGGCCTG
GGATATGGGTTTTAAATGGACATTGTCTGTACCAGCTTCATTAAAATAAACAATATTTGT
AAAAATCAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_003352
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003352.4, NP_003343.1
RefSeq Size 1527 bp
RefSeq ORF 306 bp
Locus ID 7341
UniProt ID P63165
Cytogenetics 2q33.1
Domains UBQ
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
Summary This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last four amino acids of the carboxy-terminus have been cleaved off. Several pseudogenes have been reported for this gene. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a).
Write Your Own Review
You're reviewing:Sumo 1 (SUMO1) (NM_003352) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200633 SUMO1 (Myc-DDK-tagged)-Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1 10 ug
$289.00
RC200633L1 Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC200633L2 Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1, mGFP tagged 10 ug
$450.00
RC200633L3 Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC200633L4 Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1, mGFP tagged 10 ug
$450.00
RG200633 SUMO1 (tGFP-tagged) - Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.