OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TIGAR (NM_020375) Human Untagged Clone

Be the first to review this product
SKU
SC320794
C12orf5 (untagged)-Human chromosome 12 open reading frame 5 (C12orf5)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA322262 Anti-C12orf5 Rabbit Polyclonal Antibody
100 ul
$305.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TIGAR or NM_020375"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TIGAR
Synonyms C12orf5; FR2BP
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_020375.2 GCGGCGCGGGGCCACCGACGGGACGCGGCTCCGGGAACATGGCTCGCTTCGCTCTGACTG
TTGTCCGGCATGGAGAAACAAGATTTAACAAGGAGAAAATAATCCAAGGACAAGGAGTAG
ATGAACCTCTTTCAGAAACTGGATTTAAACAAGCAGCAGCTGCTGGTATATTTCTGAATA
ATGTGAAGTTTACTCATGCTTTCTCCAGTGATCTCATGAGGACAAAGCAGACCATGCATG
GAATTTTGGAGAGAAGCAAATTTTGCAAAGATATGACGGTAAAGTATGACTCAAGACTTC
GGGAAAGGAAATACGGGGTTGTAGAAGGCAAAGCGCTAAGTGAGCTGAGGGCCATGGCCA
AAGCAGCCAGGGAAGAGTGCCCTGTGTTTACACCGCCCGGAGGAGAGACGCTGGACCAGG
TGAAAATGCGTGGAATAGACTTTTTTGAATTTCTTTGTCAACTAATCCTGAAAGAAGCGG
ATCAAAAAGAACAGTTTTCCCAAGGATCTCCAAGCAACTGTCTGGAAACTTCTTTGGCAG
AGATATTTCCTTTAGGAAAAAATCACAGCTCTAAAGTTAATTCAGACAGCGGTATTCCAG
GATTAGCAGCCAGTGTCTTAGTTGTGAGTCACGGTGCTTACATGAGAAGTCTGTTTGATT
ATTTTCTGACTGACCTTAAGTGTTCCTTACCAGCCACTCTGAGCAGATCTGAACTTATGT
CAGTCACTCCCAATACAGGGATGAGTCTCTTTATCATAAACTTTGAGGAAGGAAGAGAAG
TTAAACCAACGGTTCAGTGTATTTGTATGAACCTACAGGATCATCTAAATGGACTGACTG
AAACTCGCTAAGGTTAAATCTGCATCAAAATCTAACCATTTTGAGCCTCTGAAGGGAGTG
CCATTGGCTTTATTTACTTCTCTCCTCTGCTAGTTCTGATTTGGAAACAGTTAAAAGCCA
ATTTTTAGCTCCAGTGGAACCATAGCCACATAAAACTTTAATGGACAACCATATAGAATT
AACTTATTTTGTCTAAGTACAGTTGGCATTTTCCAGAATAATTTTACCACCCTGCTAGAT
GTCATCTCTGGATTGCACATGGATGATGAAGGAACTCAGCATTGAAAGTTGGGGGATTAA
TAACCTTGTTACAACGGTTTCTTTTTCATTTTAGCCTATTTTAATGGCTATTGGTAAGAT
ACTGTATGTTTTTAGTATCTCATCCAGTGCTTAGAAGAAAGAATGGTTTATAATTCCCAG
TACATGTTTATATTGACTGTGTTATATTTTTAAATCCTTTAAATAAAAAATCCTTATAAG
TTTATGTAAAGCAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_020375
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_020375.2, NP_065108.1
RefSeq Size 8237 bp
RefSeq ORF 813 bp
Locus ID 57103
UniProt ID Q9NQ88
Cytogenetics 12p13.32
Domains PGAM
Summary This gene is regulated as part of the p53 tumor suppressor pathway and encodes a protein with sequence similarity to the bisphosphate domain of the glycolytic enzyme that degrades fructose-2,6-bisphosphate. The protein functions by blocking glycolysis and directing the pathway into the pentose phosphate shunt. Expression of this protein also protects cells from DNA damaging reactive oxygen species and provides some protection from DNA damage-induced apoptosis. The 12p13.32 region that includes this gene is paralogous to the 11q13.3 region. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_020375" in other vectors (7)
SKU Description Size Price
RC204087 C12orf5 (Myc-DDK-tagged)-Human chromosome 12 open reading frame 5 (C12orf5) 10 ug
$300.00
RC204087L1 Lenti ORF clone of Human chromosome 12 open reading frame 5 (C12orf5), Myc-DDK-tagged 10 ug
$600.00
RC204087L2 Lenti ORF clone of Human chromosome 12 open reading frame 5 (C12orf5), mGFP tagged 10 ug
$600.00
RC204087L3 Lenti ORF clone of Human chromosome 12 open reading frame 5 (C12orf5), Myc-DDK-tagged 10 ug
$600.00
RC204087L4 Lenti ORF clone of Human chromosome 12 open reading frame 5 (C12orf5), mGFP tagged 10 ug
$600.00
RG204087 C12orf5 (tGFP-tagged) - Human chromosome 12 open reading frame 5 (C12orf5) 10 ug
$489.00 $500.00
SC113108 C12orf5 (untagged)-Human chromosome 12 open reading frame 5 (C12orf5) 10 ug
$300.00

file-alt Citations

Four Key Steps Control Glycolytic Flux in Mammalian Cells
Tanner, Goglia, Wei et al
Cell Syst (2018) 7 (1), 49-62.e8 DOI: 10.1016/j.cels.2018.06.003
AI Summary: OriGene contributed to this study by providing the PDK1 (NM_002610) Human cDNA Clone (Cat# SC321678), which was used to overexpress PDK1 and assess its role in controlling glycolytic flux in mammalian cells.
Snippet: PDK1: PDK1 (NM_002610) Human cDNA Clone Origene Cat# SC321678 PFKFB1: MGC Human PFKFB1 Sequence-Verified cDNA (CloneId:40000713) Dharmacon Cat# MHS6278-211689324 PFKFB2: MGC Human PFKFB2 Sequence-Verified cDNA (CloneId:30915381) Dharmacon Cat# MHS6278-202856883
Figure
The fructose-2,6-bisphosphatase TIGAR suppresses NF-κB signaling by directly inhibiting the linear ubiquitin assembly complex LUBAC
Tang, Kwon, Neel et al
J. Biol. Chem. (2018)
AI Summary: OriGene's PowerPrep HP Plasmid Maxiprep Kits were used to purify plasmid DNA for lentiviral production, enabling the study of TIGAR's role in regulating NF-κB signaling in this research.
Snippet: The plasmid DNAs were transformed and amplified in Mix & Go Competent Cells - Strain HB 101 (Zymo Research, Cat#T3013, Irvine, CA) and purified using the PowerPrep HP Plasmid Maxiprep Kits with Prefilters (Origene, Rockville, MD) and were transfected into human embryonic kidney 293T cells along with Lentiviral Packaging Mix (Sigma -Aldrich) to produce lentiviruses per the manufacturer’s instructio...
Inhibition of c-Met downregulates TIGAR expression and reduces NADPH production leading to cell death
Lui, Wong, Ho et al
Oncogene (2011) 30 (9), 1127-34 DOI: 10.1038/onc.2010.490
Cited by 59
AI Summary: OriGene products contributed to this study by providing the TIGAR overexpression plasmid (Cat# RC222830), which was used to demonstrate that TIGAR overexpression could rescue cells from the effects of c-Met inhibition, thereby confirming TIGAR’s role in mediating cell death upon c-Met downregulation.
FigureFigure
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products