OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CAVIN3 (NM_145040) Human Untagged Clone

Be the first to review this product
SKU
SC320781
PRKCDBP (untagged)-Human protein kinase C, delta binding protein (PRKCDBP)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA320081 Rabbit Polyclonal PRKCDBP Antibody
100 ug
$640.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CAVIN3 or NM_145040"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CAVIN3
Synonyms cavin-3; HSRBC; PRKCDBP; SRBC
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_145040.2 GTTGCAGGCAGACGGAGCAGAGCGGTCAGGGATCATGAGGGAGAGTGCGTTGGAGCCGGG
GCCTGTGCCCGAGGCGCCGGCGGGGGGTCCCGTGCACGCCGTGACGGTGGTGACCCTGCT
GGAGAAGCTGGCCTCCATGCTGGAGACTCTGCGGGAGCGGCAGGGAGGCCTGGCTCGAAG
GCAGGGAGGCCTGGCAGGGTCCGTGCGCCGCATCCAGAGCGGCCTGGGCGCTCTGAGTCG
CAGCCACGACACCACCAGCAACACCTTGGCGCAGCTGCTGGCCAAGGCGGAGCGCGTGAG
CTCGCACGCCAACGCCGCCCAAGAGCGCGCGGTGCGCCGCGCAGCCCAGGTGCAGCGGCT
GGAGGCCAACCACGGGCTGCTGGTGGCGCGCGGGAAGCTCCACGTTCTGCTCTTCAAGGA
GGAGGGTGAAGTCCCAGCCAGCGCTTTCCAGAAGGCACCAGAGCCCTTGGGCCCGGCGGA
CCAGTCCGAGCTGGGCCCAGAGCAGCTGGAGGCCGAAGTTGGAGAGAGCTCGGACGAGGA
GCCGGTGGAGTCCAGGGCCCAGCGGCTGCGGCGCACCGGATTGCAGAAGGTACAGAGCCT
CCGAAGGGCCCTTTCGGGCCGGAAAGGCCCTGCAGCGCCACCGCCCACCCCGGTCAAGCC
GCCTCGCCTTGGGCCTGGCCGGAGCGCTGAAGCCCAGCCGGAAGCCCAGCCTGCGCTGGA
GCCCACGCTGGAGCCAGAGCCTCCGCAGGACACCGAGGAAGATCCCGGGAGACCTGGGGC
TGCCGAAGAAGCTCTGCTCCAAATGGAGAGTGTAGCCTGAGGGCTGGTGTTGCCTGCCTC
CCCTGTGCTTGTGCCTTGTCCCAAAATAAATCCTTTCAGAATGTAGCACTCACGCCCTAA
TAAGGAGCGAATCCTACATCCACCAAGGCGGGCGCTCTGGCCCTCCCTTCCTTAAGCCCA
GTCCTGTGTCCTCTGAAAGAGGTGCAGTCACTCACACCTGCTTGCGCTCACCATCAATAA
AAGTAATTTCACCCGAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_145040
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_145040.2, NP_659477.2
RefSeq Size 1039 bp
RefSeq ORF 786 bp
Locus ID 112464
UniProt ID Q969G5
Cytogenetics 11p15.4
Protein Families Druggable Genome
Summary The protein encoded by this gene was identified as a binding protein of the protein kinase C, delta (PRKCD). The expression of this gene in cultured cell lines is strongly induced by serum starvation. The expression of this protein was found to be down-regulated in various cancer cell lines, suggesting the possible tumor suppressor function of this protein. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_145040" in other vectors (7)
SKU Description Size Price
RC204254 PRKCDBP (Myc-DDK-tagged)-Human protein kinase C, delta binding protein (PRKCDBP) 10 ug
$300.00
RC204254L1 Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), Myc-DDK-tagged 10 ug
$600.00
RC204254L2 Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), mGFP tagged 10 ug
$600.00
RC204254L3 Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), Myc-DDK-tagged 10 ug
$600.00
RC204254L4 Lenti ORF clone of Human protein kinase C, delta binding protein (PRKCDBP), mGFP tagged 10 ug
$600.00
RG204254 PRKCDBP (tGFP-tagged) - Human protein kinase C, delta binding protein (PRKCDBP) 10 ug
$489.00 $500.00
SC311245 PRKCDBP (untagged)-Human protein kinase C, delta binding protein (PRKCDBP) 10 ug
$330.00

file-alt Citations

Epigenetic Inactivation of the BRCA1 Interactor SRBC and Resistance to Oxaliplatin in Colorectal Cancer
Moutinho, Martinez-Cardús, Santos et al
J. Natl. Cancer Inst. (2013)
Cited by 99
AI Summary: OriGene products, specifically human SRBC cDNA plasmids and short hairpin RNAs (shRNAs), were used for transfection and gene depletion experiments to assess the role of SRBC in oxaliplatin sensitivity and resistance in colorectal cancer cells.
Snippet: SRBC Transfection and Depletion Experiments. Human short hairpin RNAs and cDNA plasmids for SRBC were obtained from Origene (Rockville, MD). After Escherichia coli transformation, we proceeded to plasmid DNA purification. ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products