OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PPT2 (NM_005155) Human Untagged Clone

Be the first to review this product
SKU
SC320220
PPT2 (untagged)-Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA359488 PPT2 Antibody - C-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PPT2 or NM_005155"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PPT2
Synonyms C6orf8; G14; PPT-2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_005155, the custom clone sequence may differ by one or more nucleotides


ATGCTGGGGCTCTGCGGGCAGCGGCTCCCCGCGGCGTGGGTCCTGCTTCTGTTGCCTTTCCTGCCGCTGC
TGCTGCTTGCAGCCCCCGCGCCCCACCGCGCGTCCTACAAGCCGGTCATCGTGGTGCATGGGCTCTTCGA
CAGCTCGTACAGCTTCCGCCACCTGCTGGAATACATCAATGAGACACACCCCGGGACTGTGGTGACAGTG
CTCGATCTCTTCGATGGGAGAGAGAGCTTGCGACCCCTGTGGGAACAGGTGCAAGGGTTCCGAGAGGCTG
TGGTCCCCATCATGGCAAAGGCCCCTCAAGGGGTGCATCTCATCTGCTACTCGCAGGGGGGCCTTGTGTG
CCGGGCTCTGCTTTCTGTCATGGATGATCACAACGTGGATTCTTTCATCTCCCTCTCCTCTCCACAGATG
GGACAGTATGGAGACACGGACTACTTGAAGTGGCTGTTCCCCACCTCCATGCGGTCTAACCTCTATCGGA
TCTGCTATAGCCCCTGGGGCCAGGAATTCTCCATCTGCAACTACTGGCATGATCCCCACCACGATGACTT
GTACCTCAATGCCAGCAGCTTCCTGGCCCTGATCAATGGGGAAAGAGACCATCCCAATGCCACAGTATGG
CGGAAGAACTTTCTGCGTGTGGGCCACCTGGTGCTGATTGGGGGCCCTGATGATGGTGTTATTACTCCCT
GGCAGTCCAGCTTCTTTGGTTTCTATGATGCAAATGAGACCGTCCTGGAGATGGAGGAGCAACTGGTTTA
TCTGCGGGATTCTTTTGGGTTGAAGACTCTATTGGCCCGGGGGGCCATAGTGAGGTGTCCAATGGCCGGT
ATCTCCCACACAGCCTGGCACTCCAACCGTACCCTTTATGAGACCTGCATTGAACCTTGGCTCTCCTGA
Restriction Sites Please inquire |
ACCN NM_005155
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005155.5, NP_005146.3
RefSeq Size 2202 bp
RefSeq ORF 909 bp
Locus ID 9374
UniProt ID Q9UMR5
Cytogenetics 6p21.32
Protein Families Transmembrane
Protein Pathways Fatty acid elongation in mitochondria, Lysosome, Metabolic pathways
Summary This gene encodes a member of the palmitoyl-protein thioesterase family. The encoded glycosylated lysosomal protein has palmitoyl-CoA hydrolase activity in vitro, but does not hydrolyze palmitate from cysteine residues in proteins. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream EGFL8 (EGF-like-domain, multiple 8) gene. provided by RefSeq, Feb 2011
Transcript Variant: This variant (1) represents the longest transcript and encodes the shorter isoform (a). Both variants 1 and 3 encode the same isoform.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_005155" in other vectors (6)
SKU Description Size Price
RC200272 PPT2 (Myc-DDK-tagged)-Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1 10 ug
$300.00
RC200272L1 Lenti ORF clone of Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200272L2 Lenti ORF clone of Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1, mGFP tagged 10 ug
$600.00
RC200272L3 Lenti ORF clone of Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200272L4 Lenti ORF clone of Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1, mGFP tagged 10 ug
$600.00
RG200272 PPT2 (tGFP-tagged) - Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products