OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

GRB2 (NM_002086) Human Untagged Clone

Be the first to review this product
SKU
SC319370
GRB2 (untagged)-Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA357448 GRB2 Antibody - N-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "GRB2 or NM_002086"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GRB2
Synonyms ASH; EGFRBP-GRB2; Grb3-3; MST084; MSTP084; NCKAP2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002086.3 GACCGGGCGGCGGCAGCGGCGGCGGCGGCTGTGGCAGAGTCTGTGCCTGTGGCGGTGACG
GCGGCGGGAGCAAGCGCTGCCCTCGCAGAGCAGCCTTGGGGTCGCCGGCCGCTCGCAGCG
TTGTGGAGGGGCGGGCCGGACGCTGAGCGGAGCAGCTGCGCCACGGGTGGCATTGTGTGT
CCCAGAGTGCCGGAGCGAGTCCCAGAAGAGAGGCGAGGCTAAGCCCAGAGCGCTGGGTTG
CTTCAGCAGGGAAGACTCCCTTCCCCCTGCTTCAGGCTGCTGAGCACTGAGCAGCGCTCA
GAATGGAAGCCATCGCCAAATATGACTTCAAAGCTACTGCAGACGACGAGCTGAGCTTCA
AAAGGGGGGACATCCTCAAGGTTTTGAACGAAGAATGTGATCAGAACTGGTACAAGGCAG
AGCTTAATGGAAAAGACGGCTTCATTCCCAAGAACTACATAGAAATGAAACCACATCCGT
GGTTTTTTGGCAAAATCCCCAGAGCCAAGGCAGAAGAAATGCTTAGCAAACAGCGGCACG
ATGGGGCCTTTCTTATCCGAGAGAGTGAGAGCGCTCCTGGGGACTTCTCCCTCTCTGTCA
AGTTTGGAAACGATGTGCAGCACTTCAAGGTGCTCCGAGATGGAGCCGGGAAGTACTTCC
TCTGGGTGGTGAAGTTCAATTCTTTGAATGAGCTGGTGGATTATCACAGATCTACATCTG
TCTCCAGAAACCAGCAGATATTCCTGCGGGACATAGAACAGGTGCCACAGCAGCCGACAT
ACGTCCAGGCCCTCTTTGACTTTGATCCCCAGGAGGATGGAGAGCTGGGCTTCCGCCGGG
GAGATTTTATCCATGTCATGGATAACTCAGACCCCAACTGGTGGAAAGGAGCTTGCCACG
GGCAGACCGGCATGTTTCCCCGCAATTATGTCACCCCCGTGAACCGGAACGTCTAAGAGT
CAAGAAGCAATTATTTAAAGAAAGTGAAAAATGTAAAACACATACAAAAGAATTAAACCC
ACAAGCTGCCTCTGACAGCAGCCTGTGAGGGAGTGCAGAACACCTGGCCGGGTCACCCTG
TGACCCTCTCACTTTGGTTGGAACTTTAGGGGGTGGGAGGGGGCGTTGGATTTAAAAATG
CCAAAACTTACCTATAAATTAAGAAGAGTTTTTATTACAAATTTTCACTGCTGCTCCTCT
TTCCCCTCCTTTGTCTTTTTTTTCATCCTTTTTTCTCTTCTGTCCATCAGTGCATGACGT
TTAAGGCCACGTATAGTCCTAGCTGACGCCAATAATAAAAAACAAGAAACCAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_002086
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002086.3, NP_002077.1
RefSeq Size 3317 bp
RefSeq ORF 654 bp
Locus ID 2885
UniProt ID P62993
Cytogenetics 17q25.1
Domains SH2, SH3
Protein Families Druggable Genome
Protein Pathways Acute myeloid leukemia, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Dorso-ventral axis formation, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Focal adhesion, Gap junction, Glioma, GnRH signaling pathway, Insulin signaling pathway, Jak-STAT signaling pathway, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non-small cell lung cancer, Pathways in cancer, Prostate cancer, Renal cell carcinoma, T cell receptor signaling pathway
Summary The protein encoded by this gene binds the epidermal growth factor receptor and contains one SH2 domain and two SH3 domains. Its two SH3 domains direct complex formation with proline-rich regions of other proteins, and its SH2 domain binds tyrosine phosphorylated sequences. This gene is similar to the Sem5 gene of C.elegans, which is involved in the signal transduction pathway. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002086" in other vectors (6)
SKU Description Size Price
RC200469 GRB2 (Myc-DDK-tagged)-Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1 10 ug
$300.00
RC200469L1 Lenti ORF clone of Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200469L2 Lenti ORF clone of Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1, mGFP tagged 10 ug
$600.00
RC200469L3 Lenti ORF clone of Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200469L4 Lenti ORF clone of Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1, mGFP tagged 10 ug
$600.00
RG200469 GRB2 (tGFP-tagged) - Human growth factor receptor-bound protein 2 (GRB2), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

Recruitment of the Adaptor Protein Grb2 to EGFR Tetramers
Kozer, Barua, Henderson et al
Biochemistry (2014) 53 (16), 2594-604 DOI: 10.1021/bi500182x
Cited by 50
AI Summary: OriGene contributed to this study by providing the human Grb2 transcript variant 1 plasmid (catalog no. SC111933), which was used to construct the Grb2-mRFP fusion protein for investigating Grb2 recruitment to EGFR in live cells.
Snippet: Experimental Procedures. Construction of Grb2–mRFP Plasmid Human Grb2 (growth factor receptor-bound protein-2) transcript variant 1, as 10 μg of transfection-ready DNA, was purchased from OriGene (catalog no. SC111933) in the vector pCMV6-XL5. ... Cited by 1 Cite SaveSaving
The molecular basis of phospholipase D2-induced chemotaxis: elucidation of differential pathways in macrophages and fibroblasts
Knapek, Frondorf, Post et al
Mol Cell Biol (2010) 30 (18), 4492-506 DOI: 10.1128/MCB.00229-10
AI Summary: In this study, OriGene products—specifically PLD2 siRNA, PLD1 siRNA, PLD2 expression constructs, and PLD2-K758R mutant constructs—were used to manipulate and analyze the roles of phospholipase D isoforms in cell migration and chemotaxis, enabling the authors to elucidate the distinct molecular pathways involved in macrophages and fibroblasts.
Src-dependent TrkA transactivation is required for pituitary adenylate cyclase-activating polypeptide 38-mediated Rit activation and neuronal differentiation
Shi, Jin, Andres
Mol Biol Cell (2010) 21 (9), 1597-608 DOI: 10.1091/mbc.e09-12-1033
Cited by 26
AI Summary: In this study, OriGene’s TrkA shRNA (catalog # TG313386) was used to silence TrkA expression, enabling the authors to demonstrate the requirement of TrkA in PACAP-mediated Rit activation and neuronal differentiation.
FigureFigureFigure
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products