OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

DCPS (NM_014026) Human Untagged Clone

Be the first to review this product
SKU
SC319248
DCPS (untagged)-Human decapping enzyme, scavenger (DCPS)
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA505626 DCPS mouse monoclonal antibody,clone OTI4H8 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "DCPS or NM_014026"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DCPS
Synonyms ARS; DCS1; HINT-5; HINT5; HSL1; HSPC015
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_014026.3 GGGGCTCCGCGTCCGCGGCAGCATGGCGGACGCAGCTCCTCAACTAGGCAAGAGGAAGCG
CGAATTGGACGTGGAGGAGGCCCACGCCGCCAGCACAGAGGAAAAGGAGGCAGGAGTTGG
AAATGGTACCTGTGCTCCTGTCCGCTTACCGTTCTCCGGCTTCAGACTGCAGAAGGTGCT
GAGGGAGTCTGCGCGGGACAAAATCATTTTCCTACACGGGAAGGTGAATGAGGCCTCTGA
GGATGGGGATGGAGAGGATGCCGTTGTGATCCTGGAGAAGACGCCATTTCAGGTGGAACA
GGTGGCTCAGCTCCTGACGGGCAGCCCTGAGCTCCAATTGCAGTTCTCCAATGATATCTA
CAGCACCTATCACTTGTTCCCTCCAAGACAACTGAATGATGTAAAGACGACCGTGGTTTA
CCCTGCCACAGAGAAACACCTGCAGAAGTACCTGCGCCAGGACCTCCGCCTGATCCGAGA
GACGGGAGATGACTACAGGAACATTACTTTACCCCACCTGGAGTCCCAGAGCCTCAGCAT
CCAGTGGGTGTATAACATTCTCGACAAGAAGGCTGAAGCGGACCGGATTGTTTTCGAGAA
CCCAGATCCCTCTGATGGTTTTGTCCTCATCCCTGACCTCAAGTGGAACCAACAGCAGCT
CGATGACTTGTACTTGATCGCCATCTGCCATCGCCGGGGCATCAGATCCCTACGCGACCT
TACTCCGGAGCACTTGCCGCTGCTCAGGAACATCCTCCACCAGGGGCAGGAGGCCATCCT
GCAGCGCTACCGGATGAAGGGAGACCATCTGCGAGTATACCTGCACTACCTGCCCTCCTA
CTACCACCTGCATGTGCACTTCACCGCCCTGGGCTTCGAGGCCCCCGGCTCAGGCGTGGA
GCGGGCCCACCTGCTGGCTGAGGTGATCGAGAACTTGGAGTGTGACCCTAGGCACTACCA
GCAGCGCACGCTCACCTTCGCCCTCAGGGCTGACGACCCCCTGCTCAAGCTCTTGCAGGA
GGCTCAGCAAAGCTGAATTAACTCAGGCAGAAGAGCACAGATGTGTGGGATTGGGGGAGG
AGTGGGGACAAGATTTTTTATCTCCAAGTGAATTTTCTAAAAATGTATTTTATACCGGCT
TATTCCTAGTATTGAATAAACTAGCGGGCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
A
Restriction Sites Please inquire |
ACCN NM_014026
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014026.3, NP_054745.1
RefSeq Size 1508 bp
RefSeq ORF 1014 bp
Locus ID 28960
UniProt ID Q96C86
Cytogenetics 11q24.2
Protein Pathways RNA degradation
Summary This gene encodes a member of the histidine triad family of pyrophosphatases that removes short mRNA fragments containing the 5′ mRNA cap structure, which appear in the 3′ → 5′ mRNA decay pathway, following deadenylation and exosome-mediated turnover. This enzyme hydrolyzes the triphosphate linkage of the cap structure (7-methylguanosine nucleoside triphosphate) to yield 7-methylguanosine monophosphate and nucleoside diphosphate. It protects the cell from the potentially toxic accumulation of these short, capped mRNA fragments, and regulates the activity of other cap-binding proteins, which are inhibited by their accumulation. It also acts as a transcript-specific modulator of pre-mRNA splicing and microRNA turnover. provided by RefSeq, Apr 2017
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_014026" in other vectors (4)
SKU Description Size Price
RC203052 DCPS (Myc-DDK-tagged)-Human decapping enzyme, scavenger (DCPS) 10 ug
$457.00
RC203052L3 Lenti ORF clone of Human decapping enzyme, scavenger (DCPS), Myc-DDK-tagged 10 ug
$757.00
RC203052L4 Lenti ORF clone of Human decapping enzyme, scavenger (DCPS), mGFP tagged 10 ug
$757.00
RG203052 DCPS (tGFP-tagged) - Human decapping enzyme, scavenger (DCPS) 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products