OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SETD4 (NM_001007259) Human Untagged Clone

Be the first to review this product
SKU
SC319077
SETD4 (untagged)-Human SET domain containing 4 (SETD4), transcript variant 3
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA335546 Rabbit Polyclonal Anti-SETD4 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SETD4 or NM_001007259"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SETD4
Synonyms C21orf18; C21orf27
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001007259.1 TAACGGGAGCAGAGTCGGCGGGATTGAGCATTTCCACAGAAATTACAGTTTTGTCCTTTT
TGAAAAAATAGAACTGTATTTCAGAAAAAAGAAACTACAGTTTTAGCATGCAGAAAGGAA
AAGGGAGAACAAGCCGGATCAGAAGACGAAAACTCTGCGGAAGTTCTGAATCAAGAGGAG
TGAATGAGAGCCACAAGTCTGAATTTATAGAGCTGAGGAAGTGGCTGAAAGCTAGGAAGT
TTCAAGATTCAAACTTAGCGCCTGCTTGTTTTCCAGGTACAGGAAGAGGGCTGATGAGTC
AAACATCCCTGCAGGAGGGACAGATGATTATTTCGTTGCCTGAGAGTTGCCTGCTCACCA
CGGACACAGTGATTCGAAGCTACTTAGGGGCATACATTACTAAGTGGAAGCCTCCTCCAT
CTCCTCTGCTGGCGCTGTGCACCTTTTTAGTTTCAGAAAAGCATGCTGGGCACCGATCTC
TTTGGAAGCCTTACCTGGAGATTTTACCCAAGGCGTATACCTGCCCTGTTTGTTTGGAGC
CGGAAGTGGTGAACCTTCTTCCCAAATCTTTAAAAGCAAAGGCTGAAGAGCAGAGAGCCC
ACGTGCAGGAGTTCTTTGCTTCCTCCAGAGACTTTTTCTCTTCTCTGCAGCCTCTGTTTG
CGGAGGCTGTTGACAGCATCTTCAGCTACAGTGCCCTGCTGTGGGCTTGGTGCACCGTCA
ACACCAGAGCCGTGTACCTGAGGCCCAGGCAGCGGGAATGCCTTTCTGCAGAGCCGGACA
CCTGTGCACTCGCTCCGTACCTGGACCTGCTGAATCATAGCCCACATGTCCAGGTAAAAG
CAGCGTTTAATGAAGAAACTCATTCTTACGAAATTAGAACGACTTCACGTTGGAGAAAGC
ATGAAGAGGTATTCATCTGTTACGGCCCTCACGATAATCAACGGCTGTTCCTGGAATACG
GATTTGTTTCTGTCCATAATCCTCATGCTTGTGTTTATGTCTCAAGAGGTTGGAATCAAC
TTTGTTCTTAACATTAACACTATATAATTTTTTTCCCCATTTGGAGATGTGTATTTTCAG
TTTTAATAAAAATATCAAAACCTTAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_001007259
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001007259.1, NP_001007260.1
RefSeq Size 1132 bp
RefSeq ORF 924 bp
Locus ID 54093
UniProt ID Q9NVD3
Cytogenetics 21q22.12
Summary Histone-lysine N-methyltransferase that acts as a regulator of cell proliferation, cell differentiation and inflammatory response (PubMed:31308046). Regulates the inflammatory response by mediating mono- and dimethylation of 'Lys-4' of histone H3 (H3K4me1 and H3K4me2, respectively), leading to activate the transcription of proinflammatory cytokines IL6 and TNF-alpha (By similarity). Also involved in the regulation of stem cell quiescence by catalyzing the trimethylation of 'Lys-20' of histone H4 (H4K20me3), thereby promoting heterochromatin formation (PubMed:31308046). Involved in proliferation, migration, paracrine and myogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) differs in the 5' UTR and has alternatively spliced 3' terminal exon, which causes a frame-shift compared to variant 1. The resulting shorter isoform (2) has a distinct C-terminus compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001007259" in other vectors (4)
SKU Description Size Price
RC202397 SETD4 (Myc-DDK-tagged)-Human SET domain containing 4 (SETD4), transcript variant 3 10 ug
$300.00
RC202397L3 Lenti ORF clone of Human SET domain containing 4 (SETD4), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC202397L4 Lenti ORF clone of Human SET domain containing 4 (SETD4), transcript variant 3, mGFP tagged 10 ug
$600.00
RG202397 SETD4 (tGFP-tagged) - Human SET domain containing 4 (SETD4), transcript variant 3 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products