OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

P2X6 (P2RX6) (NM_005446) Human Untagged Clone

Be the first to review this product
SKU
SC317724
P2RX6 (untagged)-Human purinergic receptor P2X, ligand-gated ion channel, 6 (P2RX6), transcript variant 1
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA338553 Rabbit Polyclonal Anti-P2RXL1 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "P2X6 or NM_005446"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol P2X6
Synonyms P2RXL1; P2X6; P2XM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317724 representing NM_005446.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGCCCGCAGCTAGCAGGAGCTGGCAGCATGGGCTCCCCAGGGGCTACGACAGGCTGGGGGCTTCTG
GATTATAAGACGGAGAAGTATGTGATGACCAGGAACTGGCGGGTGGGCGCCCTGCAGAGGCTGCTGCAG
TTTGGGATCGTGGTCTATGTGGTAGGGTGGGCTCTCCTCGCCAAAAAAGGCTACCAGGAGCGGGACCTG
GAACCCCAGTTTTCCATCATCACCAAACTCAAAGGGGTTTCCGTCACTCAGATCAAGGAGCTTGGAAAC
CGGCTGTGGGATGTGGCCGACTTCGTGAAGCCACCTCAGGGAGAGAACGTGTTCTTCTTGGTGACCAAC
TTCCTTGTGACGCCAGCCCAAGTTCAGGGCAGATGCCCAGAGCACCCGTCCGTCCCACTGGCTAACTGC
TGGGTCGACGAGGACTGCCCCGAAGGGGAGGGAGGCACACACAGCCACGGTGTAAAAACAGGCCAGTGT
GTGGTGTTCAATGGGACCCACAGGACCTGTGAGATCTGGAGTTGGTGCCCCGTGGAGAGTGGCGTTGTG
CCCTCGAGGCCCCTGCTGGCCCAGGCCCAGAACTTCACACTGTTCATCAAAAACACAGTCACCTTCAGC
AAGTTCAACTTCTCTAAGTCCAATGCCTTGGAGACCTGGGACCCCACCTATTTTAAGCACTGCCGCTAT
GAACCACAATTCAGCCCCTACTGTCCCGTGTTCCGCATTGGGGACCTCGTGGCCAAGGCTGGAGGGACC
TTCGAGGACCTGGCGTTGCTGGGTGGCTCTGTAGGCATCAGAGTTCACTGGGATTGTGACCTGGACACC
GGGGACTCTGGCTGCTGGCCTCACTACTCCTTCCAGCTGCAGGAGAAGAGCTACAACTTCAGGACAGCC
ACTCACTGGTGGGAGCAACCGGGTGTGGAGGCCCGCACCCTGCTCAAGCTCTATGGAATCCGCTTCGAC
ATCCTCGTCACCGGGCAGGCAGGGAAGTTCGGGCTCATCCCCACGGCCGTCACACTGGGCACCGGGGCA
GCTTGGCTGGGCGTGGTCACCTTTTTCTGTGACCTGCTACTGCTGTATGTGGATAGAGAAGCCCATTTC
TACTGGAGGACAAAGTATGAGGAGGCCAAGGCCCCGAAAGCAACCGCCAACTCTGTGTGGAGGGAGCTG
GCCCTTGCATCCCAAGCCCGACTGGCCGAGTGCCTCAGACGGAGCTCAGCACCTGCACCCACGGCCACT
GCTGCTGGGAGTCAGACACAGACACCAGGATGGCCCTGTCCAAGTTCTGACACCCACTTGCCAACCCAT
TCCGGGAGCCTGTAG
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_005446
Insert Size 1326 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005446.3
RefSeq Size 2754 bp
RefSeq ORF 1326 bp
Locus ID 9127
UniProt ID O15547
Cytogenetics 22q11.21
Protein Families Druggable Genome, Ion Channels: ATP Receptors, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
MW 48.8 kDa
Summary The protein encoded by this gene belongs to the family of P2X receptors, which are ATP-gated ion channels and mediate rapid and selective permeability to cations. This gene is predominantly expressed in skeletal muscle, and regulated by p53. The encoded protein is associated with VE-cadherin at the adherens junctions of human umbilical vein endothelial cells. Alternative splicing results in multiple transcript variants. A related pseudogene, which is also located on chromosome 22, has been identified. provided by RefSeq, Apr 2009
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_005446" in other vectors (5)
SKU Description Size Price
RC206536 P2RX6 (Myc-DDK-tagged)-Human purinergic receptor P2X, ligand-gated ion channel, 6 (P2RX6), transcript variant 1 10 ug
$457.00
RC206536L3 Lenti ORF clone of Human purinergic receptor P2X, ligand-gated ion channel, 6 (P2RX6), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC206536L4 Lenti ORF clone of Human purinergic receptor P2X, ligand-gated ion channel, 6 (P2RX6), transcript variant 1, mGFP tagged 10 ug
$757.00
RG206536 P2RX6 (tGFP-tagged) - Human purinergic receptor P2X, ligand-gated ion channel, 6 (P2RX6), transcript variant 1 10 ug
$489.00 $657.00
SC317723 P2RX6 (untagged)-Human purinergic receptor P2X, ligand-gated ion channel, 6 (P2RX6), transcript variant 1 10 ug
$457.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products