OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PLA2G2F (NM_022819) Human Untagged Clone

Be the first to review this product
SKU
SC317316
PLA2G2F (untagged)-Human phospholipase A2, group IIF (PLA2G2F)
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PLA2G2F or NM_022819"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PLA2G2F
Synonyms GIIFsPLA2; sPLA2-IIF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317316 representing NM_022819.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGATGGGGCAAAGGCCAACCCCAAAGGGTTCAAAAAGAAGGTGCTGGATAGATGCTTCTCTGGG
TGGAGGGGCCCACGCTTCGGGGCCTCCTGTCCTTCAAGAACCTCCAGGTCTAGCCTGGGTATGAAGAAG
TTCTTCACCGTGGCCATCCTTGCTGGCAGCGTTCTGTCCACAGCTCACGGCAGCCTGCTCAACCTGAAG
GCCATGGTGGAGGCCGTCACAGGGAGGAGCGCCATCCTGTCCTTCGTGGGCTACGGTTGCTACTGTGGG
CTGGGGGGCCGTGGCCAGCCCAAGGATGAGGTGGACTGGTGCTGCCACGCCCACGACTGCTGCTACCAG
GAACTCTTTGACCAAGGCTGTCACCCCTATGTGGACCACTATGATCACACCATCGAGAACAACACTGAG
ATAGTCTGCAGTGACCTCAACAAGACAGAGTGTGACAAGCAGACATGCATGTGTGACAAGAACATGGTT
CTGTGCCTCATGAACCAGACGTACCGAGAGGAGTACCGTGGCTTCCTCAATGTCTACTGCCAGGGCCCC
ACGCCCAACTGCAGCATCTATGAACCGCCCCCTGAGGAGGTCACCTGCAGTCACCAATCCCCAGCGCCC
CCCGCCCCTCCCTAG
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_022819
Insert Size 636 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_022819.3
RefSeq Size 2737 bp
RefSeq ORF 636 bp
Locus ID 64600
UniProt ID Q9BZM2
Cytogenetics 1p36.12
Protein Families Druggable Genome, Secreted Protein
Protein Pathways alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway
MW 23.3 kDa
Summary May play a role in lipid mediator production in inflammatory conditions, by providing arachidonic acid to downstream cyclooxygenases and lipoxygenases (By similarity). Phospholipase A2, which catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides (PubMed:11112443). Hydrolyzes phosphatidylethanolamine more efficiently than phosphatidylcholine, with only a modest preference for arachidonic acid versus linoelic acid at the sn-2 position. Comparable activity toward 1-palmitoyl-2-oleoyl-phosphatidylserine vesicles to that toward 1-palmitoyl-2-oleoyl-phosphatidylglycerol (By similarity). Hydrolyzes phosphatidylglycerol versus phosphatidylcholine with a 15-fold preference (PubMed:11112443).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes a longer protein (isoform 1), which lacks a signal peptide. With the available conservation data, it is not clear which start codon is most likely used.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_022819" in other vectors (4)
SKU Description Size Price
RC220309 PLA2G2F (Myc-DDK-tagged)-Human phospholipase A2, group IIF (PLA2G2F) 10 ug
$300.00
RC220309L3 Lenti ORF clone of Human phospholipase A2, group IIF (PLA2G2F), Myc-DDK-tagged 10 ug
$600.00
RC220309L4 Lenti ORF clone of Human phospholipase A2, group IIF (PLA2G2F), mGFP tagged 10 ug
$600.00
RG220309 PLA2G2F (tGFP-tagged) - Human phospholipase A2, group IIF (PLA2G2F) 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products