OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TDRKH (NM_001083964) Human Untagged Clone

Be the first to review this product
SKU
SC316232
TDRKH (untagged)-Human tudor and KH domain containing (TDRKH), transcript variant 4
  $529.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA360730 TDRKH Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TDRKH or NM_001083964"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TDRKH
Synonyms TDRD2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC316232 representing NM_001083964.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTACTGAACGGACTTCTTGGACAAGCCTGTCCACCATTCAGAAAATAGCCCTGGGCCTTGGGATC
CCAGCCAGTGCAACAGTTGCCTATATCCTATACCGCAGGTATAGGGAAAGCAGAGAAGAGCGGCTGACA
TTTGTTGGGGAAGATGACATTGAGATAGAGATGCGGGTTCCCCAGGAGGCTGTGAAACTCATCATTGGC
CGGCAAGGAGCCAATATTAAACAGCTGCGGAAACAGACAGGTGCTCGGATTGATGTGGACACAGAGGAT
GTAGGCGATGAGCGAGTGCTGCTTATCAGTGGTTTTCCTGTTCAGGCATCTGGAGCCAAAATTACCTGT
GACAAAGAATCAGAAGGGACATTACTACTATCAAGACTTATAAAAATCTCAGGAACACAGAAGGAAGTG
GCAGCAGCCAAGCATTTGATACTGGAGAAAGTTTCAGAAGATGAAGAACTTCGGAAGAGAATTGCTCAT
TCTGCAGAAACCAGGGTCCCACGCAAACAGCCAATCAGTGTGAGAAGAGAAGACATGACAGAGCCAGGT
GGAGCTGGAGAGCCAGCATTATGGAAAAACACCAGTTCTAGCATGGAGCCGACTGCACCCCTGGTGACT
CCTCCACCCAAAGGAGGAGGCGACATGGCTGTGGTAGTGTCAAAGGAAGGTTCCTGGGAGAAACCTAGT
GATGACAGCTTTCAGAAGTCTGAAGCCCAGGCCATCCCAGAGATGCCCATGTTTGAAATCCCCAGTCCT
GACTTCAGTTTTCATGCTGATGAGTACCTAGAAGTCTACGTTTCTGCTTCTGAGCACCCTAACCACTTC
TGGATCCAGATCGTTGGCTCCCGCAGCCTGCAATTGGATAAGCTTGTCAATGAGATGACCCAGCACTAT
GAGAATAGTGTGCCTGAAGACTTGACTGTGCATGTAGGAGACATTGTAGCAGCACCTTTACCTACAAAT
GGTTCCTGGTATCGAGCCCGGGTCCTCGGCACCTTGGAGAATGGGAACTTGGACCTCTATTTTGTTGAC
TTTGGAGATAATGGAGATTGCCCACTGAAGGACCTCAGGGCTCTCAGGAGTGACTTCCTAAGCCTTCCA
TTTCAAGCAATAGAATGTAGTCTGGCACGGATTGCTCCCTCAGGTGACCAGTGGGAAGAGGAAGCTTTG
GATGAGTTTGATAGACTCACTCATTGTGCTGACTGGAAGCCTCTGGTAGCCAAGATCTCTAGCTATGTC
CAGACTGGGATCTCAACTTGGCCAAAGATCTACTTATATGATACTAGCAATGGGAAGAAACTTGATATT
GGGCTAGAATTAGTACACAAAGGATACGCAATTGAGCTTCCTGAAGACATAGAAGAAAACAGAGCTGTC
CCAGACATGTTGAAGGACATGGCCACAGAAACAGATGCCTCTCTCAGCACGTTGCTCACTGAGACCAAA
AAGAGCTCTGGAGAGATAACACATACCCTGTCCTGCCTCAGCTTATCAGAAGCTGCTTCCATGTCTGGT
GATGATAACCTTGAAGATGACTACTTACTCTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001083964
Insert Size 1551 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001083964.1
RefSeq Size 2719 bp
RefSeq ORF 1551 bp
Locus ID 11022
UniProt ID Q9Y2W6
Cytogenetics 1q21.3
Protein Families Transmembrane
MW 57.2 kDa
Summary Participates in the primary piRNA biogenesis pathway and is required during spermatogenesis to repress transposable elements and prevent their mobilization, which is essential for the germline integrity. The piRNA metabolic process mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins and govern the methylation and subsequent repression of transposons. Required for the final steps of primary piRNA biogenesis by participating in the processing of 31-37 nt intermediates into mature piRNAs. May act in pi-bodies and piP-bodies by transferring piRNA precursors or intermediates to or between these granules.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (4) lacks an alternate inframe segment in the coding region compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001083964" in other vectors (4)
SKU Description Size Price
RC217780 TDRKH (Myc-DDK-tagged)-Human tudor and KH domain containing (TDRKH), transcript variant 4 10 ug
$480.00
RC217780L3 Lenti-ORF clone of TDRKH (Myc-DDK-tagged)-Human tudor and KH domain containing (TDRKH), transcript variant 4 10 ug
$780.00
RC217780L4 Lenti-ORF clone of TDRKH (mGFP-tagged)-Human tudor and KH domain containing (TDRKH), transcript variant 4 10 ug
$780.00
RG217780 TDRKH (tGFP-tagged) - Human tudor and KH domain containing (TDRKH), transcript variant 4 10 ug
$680.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products