OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MAP1LC3B2 (NM_001085481) Human Untagged Clone

Be the first to review this product
SKU
SC316124
MAP1LC3B2 (untagged)-Human microtubule-associated protein 1 light chain 3 beta 2 (MAP1LC3B2)
  $240.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MAP1LC3B2 or NM_001085481"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAP1LC3B2
Synonyms ATG8G
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC316124 representing NM_001085481.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGTCGGAGAAGACCTTCAAGCAGCGGCGCACCTTCGAACAAAGAGTAGAAGATGTCCGACTTATT
CGAGAGCAGCATCCAACCAAAATCCCGGTGATAATAGAACGATACAAGGGTGAGAAGCAGCTTCCTGTT
CTGGATAAAACAAAGTTCCTTGTACCTGACCATGTCAACATGAGTGAGCTCATCAAGATAATTAGAAGG
CGCTTACAGCTCAATGCTAATCAGGCCTTCTTCCTGTTGGTGAACGGACACAGCATGGTCAGCGTCTCC
ACACCAATCTCAGAGGTGTATGAGAGTGAGAAAGATGAAGATGGATTCCTGTACATGGTCTGTGCCTCC
CAGGAGACGTTCGGGATGAAATTGTCAGTGTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001085481
Insert Size 378 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001085481.1
RefSeq Size 832 bp
RefSeq ORF 378 bp
Locus ID 643246
UniProt ID A6NCE7
Cytogenetics 12q24.22
MW 14.6 kDa
Summary Ubiquitin-like modifier involved in formation of autophagosomal vacuoles (autophagosomes). Plays a role in mitophagy which contributes to regulate mitochondrial quantity and quality by eliminating the mitochondria to a basal level to fulfill cellular energy requirements and preventing excess ROS production. Whereas LC3s are involved in elongation of the phagophore membrane, the GABARAP/GATE-16 subfamily is essential for a later stage in autophagosome maturation (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001085481" in other vectors (6)
SKU Description Size Price
RC223078 MAP1LC3B2 (Myc-DDK-tagged)-Human microtubule-associated protein 1 light chain 3 beta 2 (MAP1LC3B2) 10 ug
$225.00
RC223078L1 Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 beta 2 (MAP1LC3B2), Myc-DDK-tagged 10 ug
$525.00
RC223078L2 Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 beta 2 (MAP1LC3B2), mGFP tagged 10 ug
$525.00
RC223078L3 Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 beta 2 (MAP1LC3B2), Myc-DDK-tagged 10 ug
$525.00
RC223078L4 Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 beta 2 (MAP1LC3B2), mGFP tagged 10 ug
$525.00
RG223078 MAP1LC3B2 (tGFP-tagged) - Human microtubule-associated protein 1 light chain 3 beta 2 (MAP1LC3B2) 10 ug
$425.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products