OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

UBXN2B (NM_001077619) Human Untagged Clone

Be the first to review this product
SKU
SC315531
UBXN2B (untagged)-Human UBX domain protein 2B (UBXN2B)
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA502539 UBXN2B mouse monoclonal antibody, clone OTI3H8 (formerly 3H8) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "UBXN2B or NM_001077619"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UBXN2B
Synonyms p37
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315531 representing NM_001077619.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGAGGGCGGAGGCCCTGAGCCCGGCGAGCAGGAGAGGAGGTCTTCCGGGCCGCGGCCTCCGAGC
GCGCGGGATTTGCAGTTGGCCTTGGCAGAATTGTATGAAGATGAAGTGAAGTGCAAATCTTCCAAGTCT
AATAGACCTAAAGCCACAGTCTTCAAGAGCCCACGGACACCACCTCAACGGTTTTACTCAAGTGAACAT
GAATACAGTGGATTAAATATAGTTCGACCTTCAACTGGGAAAATTGTGAATGAACTTTTCAAAGAGGCA
AGGGAACATGGGGCTGTCCCTCTGAATGAAGCCACAAGAGCTTCAGGTGATGATAAATCTAAGTCATTT
ACAGGTGGAGGATACAGATTGGGTAGTTCTTTTTGTAAGCGGTCTGAATATATCTATGGAGAAAATCAG
CTGCAAGATGTTCAGATTTTGCTTAAACTGTGGAGCAATGGTTTCAGTTTAGATGATGGAGAATTGAGA
CCTTACAATGAACCAACAAATGCTCAATTTCTGGAGTCTGTTAAGAGAGGAGAGATTCCCCTGGAGCTT
CAGCGCCTTGTTCATGGTGGCCAAGTGAATTTGGATATGGAGGATCATCAGGATCAAGAATACATAAAA
CCTAGATTGAGGTTCAAGGCTTTTAGTGGAGAAGGGCAAAAACTTGGAAGCCTTACACCTGAAATAGTC
AGTACACCTTCCTCTCCAGAAGAGGAGGATAAATCAATACTTAATGCAGTTGTTCTTATTGATGATTCA
GTGCCAACAACAAAAATTCAAATCAGGTTAGCAGATGGGAGTCGTTTGATACAAAGATTCAATAGTACA
CACAGGATCCTGGATGTCCGGAACTTTATTGTACAGTCTCGTCCTGAATTTGCGGCTCTTGACTTTATT
CTTGTGACTTCATTTCCGAATAAAGAGCTAACAGATGAAAGCCTGACACTGCTAGAAGCAGATATTCTT
AACACTGTGTTACTCCAGCAACTAAAATAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001077619
Insert Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001077619.1
RefSeq Size 5088 bp
RefSeq ORF 996 bp
Locus ID 137886
UniProt ID Q14CS0
Cytogenetics 8q12.1
MW 37.1 kDa
Summary Adapter protein required for Golgi and endoplasmic reticulum biogenesis (PubMed:17141156). Involved in Golgi and endoplasmic reticulum maintenance during interphase and in their reassembly at the end of mitosis (PubMed:17141156). The complex formed with VCP has membrane fusion activity; membrane fusion activity requires USO1-GOLGA2 tethering and BET1L (PubMed:17141156). VCPIP1 is also required, but not its deubiquitinating activity (PubMed:17141156). Together with NSFL1C/p47, regulates the centrosomal levels of kinase AURKA/Aurora A during mitotic progression by promoting AURKA removal from centrosomes in prophase (PubMed:23649807). Also, regulates spindle orientation during mitosis (PubMed:23649807).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001077619" in other vectors (6)
SKU Description Size Price
RC219137 UBXN2B (Myc-DDK-tagged)-Human UBX domain protein 2B (UBXN2B) 10 ug
$300.00
RC219137L1 Lenti ORF clone of Human UBX domain protein 2B (UBXN2B), Myc-DDK-tagged 10 ug
$600.00
RC219137L2 Lenti ORF clone of Human UBX domain protein 2B (UBXN2B), mGFP tagged 10 ug
$600.00
RC219137L3 Lenti ORF clone of Human UBX domain protein 2B (UBXN2B), Myc-DDK-tagged 10 ug
$600.00
RC219137L4 Lenti ORF clone of Human UBX domain protein 2B (UBXN2B), mGFP tagged 10 ug
$600.00
RG219137 UBXN2B (tGFP-tagged) - Human UBX domain protein 2B (UBXN2B) 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products