OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

DPH5 (NM_001077395) Human Untagged Clone

Be the first to review this product
SKU
SC315507
DPH5 (untagged)-Human DPH5 homolog (S. cerevisiae) (DPH5), transcript variant 3
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA361618 DPH5 Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "DPH5 or NM_001077395"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DPH5
Synonyms AD-018; CGI-30; HSPC143; NPD015
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315507 representing NM_001077395.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTTTATCTCATCGGGTTGGGCCTGGGAGATGCCAAGGACATCACAGTCAAGGGCCTGGAAGTTGTT
AGACGCTGCAGTCGAGTGTATCTGGAAGCCTACACCTCAGTCCTAACTGTAGGGAAGGAAGCCTTGGAA
GAGTTTTATGGAAGAAAATTGGTTGTTGCTGATAGAGAAGAAGTGGAACAAGAAGCAGATAATATTTTA
AAGGATGCTGATATCAGTGATGTTGCATTCCTTGTGGTTGGTGATCCATTTGGGGCCACAACACACAGT
GATCTTGTTCTAAGAGCAACAAAGCTGGGAATTCCTTATAGAGTTATTCACAATGCCTCCATAATGAAT
GCTGTAGGCTGCTGTGGTTTACAGTTATATAAGTTTGGAGAGACAGTTTCTATTGTTTTTTGGACAGAC
ACTTGGAGACCAGAAAGCTTCTTTGACAAAGTGAAGAAGAACAGACAAAATGGCATGCACACATTATGT
TTACTAGACATCAAAGTAAAGGAGCAGTCTTTGGAAAATCTAATCAAGGGAAGGAAGATCTATGAACCT
CCACGGTATATGAGTGTAAACCAAGCAGCCCAGCAGCTTCTGGAGATTGTTCAAAATCAAAGAATACGA
GGAGAAGAACCAGTTACCGAGGAGACACTTTGTGTTGGCTTAGCCAGGGTTGGAGCCGACGACCAGAAA
ATTGCAGCAGGCACTTTAAGGCAAATGTGCACTGTGGACTTGGGAGAACCATTGCATTCCTTGATCATC
ACAGGAGGCAGCATACATCCAATGGAGATGGAGATGCTAAGTCTGTTTTCCATACCAGAAAATAGCTCA
GAATCTCAAAGCATCAATGGACTTTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001077395
Insert Size 855 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001077395.1
RefSeq Size 1807 bp
RefSeq ORF 855 bp
Locus ID 51611
UniProt ID Q9H2P9
Cytogenetics 1p21.2
MW 31.6 kDa
Summary This gene encodes a component of the diphthamide synthesis pathway. Diphthamide is a post-translationally modified histidine residue found only on translation elongation factor 2. It is conserved from archaebacteria to humans, and is targeted by diphtheria toxin and Pseudomonas exotoxin A to halt cellular protein synthesis. The yeast and Chinese hamster homologs of this protein catalyze the trimethylation of the histidine residue on elongation factor 2, resulting in a diphthine moiety that is subsequently amidated to yield diphthamide. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The resulting protein (isoform b) is one amino acid shorter than isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001077395" in other vectors (4)
SKU Description Size Price
RC208759 DPH5 (Myc-DDK-tagged)-Human DPH5 homolog (S. cerevisiae) (DPH5), transcript variant 3 10 ug
$300.00
RC208759L3 Lenti ORF clone of Human DPH5 homolog (S. cerevisiae) (DPH5), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC208759L4 Lenti ORF clone of Human DPH5 homolog (S. cerevisiae) (DPH5), transcript variant 3, mGFP tagged 10 ug
$600.00
RG208759 DPH5 (tGFP-tagged) - Human DPH5 homolog (S. cerevisiae) (DPH5), transcript variant 3 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products