OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PAPSS1 (NM_005443) Human Untagged Clone

Be the first to review this product
SKU
SC314249
PAPSS1 (untagged)-Human 3'-phosphoadenosine 5'-phosphosulfate synthase 1 (PAPSS1)
  $872.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA349567 Rabbit Polyclonal Anti-PAPSS1 Antibody
100 ul
$205.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PAPSS1 or NM_005443"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PAPSS1
Synonyms ATPSK1; PAPSS; SK1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_005443, the custom clone sequence may differ by one or more nucleotides


ATGGAGATCCCCGGGAGCCTGTGCAAGAAAGTCAAACTGAGCAATAACGCGCAGAACTGGGGAATGCAGA
GAGCAACCAATGTCACCTACCAAGCCCATCATGTCAGCAGGAACAAGAGAGGTCAGGTGGTGGGGACCAG
AGGTGGCTTTCGTGGTTGCACAGTTTGGCTAACAGGCTTGTCTGGAGCGGGAAAGACTACTGTGAGCATG
GCCTTGGAGGAGTACCTGGTTTGTCATGGTATTCCATGCTACACTCTGGATGGTGACAATATTCGTCAAG
GTCTCAATAAAAATCTTGGCTTTAGTCCTGAAGACAGAGAAGAGAATGTTCGACGCATCGCAGAAGTTGC
TAAACTGTTTGCAGATGCTGGCTTAGTGTGCATCACAAGTTTCATATCACCTTACACTCAGGATCGCAAC
AATGCAAGGCAAATTCATGAAGGTGCAAGTTTACCGTTTTTTGAAGTATTTGTTGATGCTCCTCTGCATG
TTTGTGAACAGAGGGATGTCAAAGGACTCTACAAAAAAGCCCGGGCAGGAGAAATTAAAGGTTTCACTGG
GATCGATTCTGAATATGAAAAGCCAGAGGCCCCTGAGTTGGTGCTGAAAACAGACTCCTGTGATGTAAAT
GACTGTGTCCAGCAAGTTGTGGAACTTCTACAGGAACGGGATATTGTACCTGTGGATGCATCTTATGAAG
TAAAAGAACTATATGTGCCAGAAAATAAACTTCATTTGGCAAAAACAGATGCGGAAACATTACCAGCACT
GAAAATTAATAAAGTGGATATGCAGTGGGTGCAGGTTTTGGCAGAAGGTTGGGCAACCCCATTGAATGGC
TTTATGAGAGAGAGGGAGTACTTGCAGTGCCTTCATTTTGATTGTCTTCTGGATGGAGGTGTCATTAACT
TGTCAGTACCTATAGTTCTGACTGCGACTCATGAAGATAAAGAGAGGCTGGACGGCTGTACAGCATTTGC
TCTGATGTATGAGGGCCGCCGTGTGGCCATTCTTCGCAATCCAGAGTTTTTTGAGCACAGGAAAGAGGAG
CGCTGTGCCAGACAGTGGGGAACGACATGCAAGAACCACCCCTATATTAAGATGGTGATGGAACAAGGAG
ATTGGCTGATTGGAGGAGATCTTCAAGTCTTGGATCGAGTTTATTGGAATGATGGTCTTGATCAGTATCG
TCTTACTCCTACTGAGCTAAAGCAGAAATTTAAAGATATGAATGCTGATGCTGTCTTTGCATTTCAACTA
CGCAACCCAGTGCACAATGGACATGCCCTGTTAATGCAGGATACCCATAAGCAACTTCTAGAGAGGGGCT
ACCGGCGCCCTGTCCTCCTCCTCCACCCTCTGGGTGGCTGGACAAAGGATGACGATGTTCCTTTGATGTG
GCGTATGAAGCAGCATGCTGCAGTGTTGGAGGAAGGAGTTCTGAATCCTGAGACGACAGTGGTGGCCATC
TTCCCATCTCCCATGATGTATGCTGGACCAACTGAGGTCCAGTGGCATTGCAGAGCACGGATGGTTGCAG
GAGCCAACTTTTACATTGTTGGACGAGACCCTGCTGGCATGCCTCATCCAGAAACAGGGAAGGATCTTTA
TGAGCCAAGTCATGGTGCCAAAGTGCTGACGATGGCCCCTGGTTTAATCACTTTGGAAATAGTTCCCTTT
CGAGTTGCAGCTTACAACAAGAAAAAGAAGCGTATGGACTACTATGACTCTGAACACCATGAAGACTTTG
AATTTATTTCAGGAACACGAATGCGCAAACTTGCTCGAGAAGGCCAGAAACCACCTGAAGGTTTCATGGC
TCCCAAGGCTTGGACCGTGCTGACAGAATACTACAAATCCTTGGAGAAAGCTTAG
Restriction Sites Please inquire |
ACCN NM_005443
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005443.4, NP_005434.4
RefSeq Size 2558 bp
RefSeq ORF 1875 bp
Locus ID 9061
UniProt ID O43252
Cytogenetics 4q25
Domains APS_kinase, ATP-sulfurylase
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism, Selenoamino acid metabolism, Sulfur metabolism
Summary Three-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS) is the sulfate donor cosubstrate for all sulfotransferase (SULT) enzymes (Xu et al., 2000 PubMed 10679223). SULTs catalyze the sulfate conjugation of many endogenous and exogenous compounds, including drugs and other xenobiotics. In humans, PAPS is synthesized from adenosine 5-prime triphosphate (ATP) and inorganic sulfate by 2 isoforms, PAPSS1 and PAPSS2 (MIM 603005).supplied by OMIM, Mar 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_005443" in other vectors (4)
SKU Description Size Price
RC217023 PAPSS1 (Myc-DDK-tagged)-Human 3'-phosphoadenosine 5'-phosphosulfate synthase 1 (PAPSS1) 10 ug
$871.00
RC217023L3 Lenti ORF clone of Human 3'-phosphoadenosine 5'-phosphosulfate synthase 1 (PAPSS1), Myc-DDK-tagged 10 ug
$1,171.00
RC217023L4 Lenti ORF clone of Human 3'-phosphoadenosine 5'-phosphosulfate synthase 1 (PAPSS1), mGFP tagged 10 ug
$1,171.00
RG217023 PAPSS1 (tGFP-tagged) - Human 3'-phosphoadenosine 5'-phosphosulfate synthase 1 (PAPSS1) 10 ug
$1,071.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products