OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

GFM2 (NM_170681) Human Untagged Clone

Be the first to review this product
SKU
SC313793
GFM2 (untagged)-Human G elongation factor, mitochondrial 2 (GFM2), nuclear gene encoding mitochondrial protein, transcript variant 3
  $526.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA315912 Rabbit polyclonal anti-GFM2 antibody
100 ul
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "GFM2 or NM_170681"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GFM2
Synonyms EF-G2mt; EFG2; hEFG2; mEF-G 2; MRRF2; MST027; MSTP027; RRF; RRF2; RRF2mt
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313793 representing NM_170681.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTGACCAACTTGAGGATATTTGCAATGAGTCATCAGACAATACCCAGTGTGTATATTAATAATATA
TGCTGCTATAAAATAAGAGCAAGTTTAAAAAGATTAAAGCCACATGTGCCGCTTGGAAGAAATTGCAGT
TCTCTACCAGGCTTAATAGGAAATGATATCAAATCCCTTCATTCCATCATCAATCCTCCCATAGCTAAA
ATCCGTAATATTGGAATTATGGCTCATATTGATGCAGGCAAAACTACCACCACAGAAAGAATATTGTAC
TATTCCGGATATACAAGATCACTGGGAGATGTTGATGATGGAGACACAGTGACAGATTTCATGGCCCAA
GAGCGAGAAAGAGGCATTACTATTCAATCAGCTGCTGTTACATTTGATTGGAAAGGTTATAGAGTCAAT
CTAATTGATACACCAGGTCATGTGGACTTTACCTTGGAGGTTGAGCGGTGCCTAAGAGTGTTGGATGGT
GCAGTGGCTGTATTTGATGCCTCTGCTGGTGTAGAGGCCCAGACTCTCACAGTATGGAGGCAAGCTGAT
AAACACAATATACCTCGAATCTGTTTTTTAAACAAGATGGACAAAACTGGAGCAAGCTTTAAGTATGCA
GTTGAAAGCATCAGAGAGAAGTTAAAGGCAAAGCCTTTGCTTTTACAGTTACCAATTGGTGAAGCCAAA
ACTTTCAAAGGAGTGGTGGATGTAGTAATGAAAGAAAAACTTCTTTGGAATTGCAATTCAAATGATGGA
AAAGACTTTGAGAGAAAGCCCCTCTTGGAAATGAATGATCCTGAATTGCTGAAGGAAACAACTGAAGCA
AGGAATGCCTTAATTGAACAAGTTGCAGATTTGGATGATGAATTTGCTGACTTGGTTTTAGAAGAATTT
AGTGAGAATTTTGATTTGTTACCAGCTGAAAAGCTACAGACTGCAATACATAGAGTGACACTAGCTCAG
ACAGCAGTGCCTGTGCTTTGTGGAAGTGCCCTGAAAAACAAAGGGATACAGCCCTTGTTAGATGCTGTT
ACTATGTACTTACCTTCACCTGAAGAGCGTAACTATGAATTTCTGCAGTGGTATAAGGATGACTTATGT
GCATTGGCATTTAAAGTTCTCCATGACAAGCAGCGAGGACCACTGGTTTTTATGCGCATTTACTCAGGC
ACTATAAAACCCCAGTTGGCCATTCATAATATTAATGGAAACTGCACGGAGAGAATAAGTCGTCTGCTT
TTGCCGTTTGCTGACCAACATGTAGAAATCCCTTCATTGACTGCTGGTAACATTGCTTTGACTGTTGGG
CTTAAACATACTGCCACTGGAGACACCATTGTCTCATCCAAGTCCAGTGCATTAGCTGCAGCTCGTAGA
GCCGAACGGGAGGGAGAAAAGAAGCACAGACAAAACAATGAAGCAGAGAGACTTTTATTGGCTGGAGTG
GAGATTCCAGAACCTGTTTTCTTCTGTACCATAGAACCCCCATCACTGTCTAAGCAGCCAGGTATAAAT
GGTCTTAGTGTGTCAACTAATTAG
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_170681
Insert Size 1542 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_170681.2
RefSeq Size 2420 bp
RefSeq ORF 1542 bp
Locus ID 84340
UniProt ID Q969S9
Cytogenetics 5q13.3
MW 57.1 kDa
Summary Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors, which is a GTPase that plays a role at the termination of mitochondrial translation by mediating the disassembly of ribosomes from messenger RNA . Its role in the regulation of normal mitochondrial function and in disease states attributed to mitochondrial dysfunction is not known. Alternative splicing results in multiple transcript variants encoding distinct isoforms. provided by RefSeq, Jul 2013
Transcript Variant: This variant (3) lacks an alternate exon in the 5' coding region, contains an alternate 3' terminal exon and initiates translation at a downstream start codon, compared to variant 4. It encodes isoform 3, which is shorter and has a distinct C-terminus, compared to isoform 4.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_170681" in other vectors (4)
SKU Description Size Price
RC213111 GFM2 (Myc-DDK-tagged)-Human G elongation factor, mitochondrial 2 (GFM2), nuclear gene encoding mitochondrial protein, transcript variant 3 10 ug
$478.00
RC213111L3 Lenti-ORF clone of GFM2 (Myc-DDK-tagged)-Human G elongation factor, mitochondrial 2 (GFM2), nuclear gene encoding mitochondrial protein, transcript variant 3 10 ug
$778.00
RC213111L4 Lenti-ORF clone of GFM2 (mGFP-tagged)-Human G elongation factor, mitochondrial 2 (GFM2), nuclear gene encoding mitochondrial protein, transcript variant 3 10 ug
$778.00
RG213111 GFM2 (tGFP-tagged) - Human G elongation factor, mitochondrial 2 (GFM2), nuclear gene encoding mitochondrial protein, transcript variant 3 10 ug
$678.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products