OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

RANBP3 (NM_007320) Human Untagged Clone

Be the first to review this product
SKU
SC313739
RANBP3 (untagged)-Human RAN binding protein 3 (RANBP3), transcript variant RANBP3-b
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA344302 Rabbit Polyclonal Anti-RANBP3 Antibody - N-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "RANBP3 or NM_007320"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RANBP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313739 representing NM_007320.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCATTGCTCCGCCCGTCTTTGTGTTTCAGAAGGATAAA
GGACAAAAGAGGTCAGCTGGCGGCTCCAGTCCTGAAGGCGGAGAAGATTCTGACAGAGAAGATGGAAAT
TACTGCCCTCCTGTCAAGCGAGAAAGAACATCCTCTTTAACCCAGTTCCCACCCTCACAGTCAGAGGAA
AGGAGCAGTGGCTTCCGGTTGAAGCCACCAACGCTGATCCACGGCCAAGCCCCCAGCGCAGGTCTGCCA
AGCCAGAAGCCCAAGGAGCAGCAGCGGAGCGTGCTTCGCCCGGCAGTGTTACAAGCTCCGCAGCCAAAG
GCGCTGTCCCAGACTGTCCCCAGCAGTGGCACCAACGGGGTCAGCCTCCCAGCAGACTGCACGGGGGCA
GTGCCCGCAGCATCCCCTGACACTGCTGCATGGAGAAGTCCTTCCGAAGCTGCCGATGAGGTGTGTGCA
CTTGAGGAGAAAGAGCCCCAGAAAAATGAGTCCAGCAATGCCTCTGAAGAGGAAGCCTGTGAGAAAAAA
GACCCCGCCACACAGCAAGCCTTTGTATTTGGGCAGAACTTGAGGGACAGAGTTAAGCTGATAAATGAG
AGCGTGGACGAAGCCGACATGGAGAATGCTGGACACCCCAGCGCAGACACGCCAACCGCAACGAACTAT
TTCCTCCAGTATATCAGTTCCAGTTTAGAGAACTCAACCAATAGTGCCGACGCCTCCAGCAACAAATTT
GTATTTGGCCAGAACATGAGCGAGCGAGTTTTGAGCCCCCCAAAATTAAACGAGGTCAGTTCAGATGCC
AACAGGGAAAATGCAGCTGCCGAGTCAGGGTCTGAGTCCTCGTCCCAGGAGGCCACCCCTGAGAAAGAG
TCCCTGGCTGAGTCGGCAGCCGCCTACACCAAGGCAACAGCGCGGAAGTGTTTGTTGGAAAAAGTGGAA
GTCATCACCGGGGAGGAGGCGGAGAGCAATGTGTTACAGATGCAGTGCAAGCTGTTTGTCTTTGACAAG
ACCTCACAGTCCTGGGTGGAGAGAGGCCGGGGGCTGCTCAGACTCAATGACATGGCGTCCACCGATGAC
GGCACACTACAGTCCCGACTAGTGATGCGGACCCAGGGGAGCCTGCGACTGATCCTCAACACCAAGCTG
TGGGCCCAGATGCAGATCGACAAGGCCAGCGAGAAGAGCATTCGCATCACAGCCATGGACACCGAGGAC
CAGGGCGTGAAGGTCTTCCTGATCTCGGCCAGCTCCAAGGACACAGGTCAGTTGTATGCAGCCCTGCAC
CACCGCATCCTGGCCCTGCGCAGCCGCGTGGAGCAGGAGCAGGAGGCCAAGATGCCCGCGCCTGAGCCT
GGGGCAGCCCCATCCAACGAGGAGGACGACAGCGACGATGACGATGTCCTGGCTCCTTCAGGGGCCACC
GCAGCTGGTGCTGGTGACGAAGGGGACGGGCAGACGACCGGGAGCACATAG
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_007320
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007320.2
RefSeq Size 3211 bp
RefSeq ORF 1500 bp
Locus ID 8498
UniProt ID Q9H6Z4
Cytogenetics 19p13.3
Domains Ran_BP1
MW 53.4 kDa
Summary This gene encodes a protein with a RanBD1 domain that is found in both the nucleus and cytoplasm. This protein plays a role in nuclear export as part of a heteromeric complex. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. provided by RefSeq, Jul 2008
Transcript Variant: This variant (RANBP3-b) lacks an alternate in-frame exon, compared to variant RANBP3-d, resulting in a shorter protein (isoform RANBP3-b), compared to isoform RANBP3-d.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_007320" in other vectors (6)
SKU Description Size Price
RC224944 RANBP3 (Myc-DDK-tagged)-Human RAN binding protein 3 (RANBP3), transcript variant RANBP3-b 10 ug
$457.00
RC224944L1 Lenti ORF clone of Human RAN binding protein 3 (RANBP3), transcript variant RANBP3-b, Myc-DDK-tagged 10 ug
$757.00
RC224944L2 Lenti ORF clone of Human RAN binding protein 3 (RANBP3), transcript variant RANBP3-b, mGFP tagged 10 ug
$757.00
RC224944L3 Lenti ORF clone of Human RAN binding protein 3 (RANBP3), transcript variant RANBP3-b, Myc-DDK-tagged 10 ug
$757.00
RC224944L4 Lenti ORF clone of Human RAN binding protein 3 (RANBP3), transcript variant RANBP3-b, mGFP tagged 10 ug
$757.00
RG224944 RANBP3 (tGFP-tagged) - Human RAN binding protein 3 (RANBP3), transcript variant RANBP3-b 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products