OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CLEC10A (NM_006344) Human Untagged Clone

Be the first to review this product
SKU
SC312828
CLEC10A (untagged)-Human C-type lectin domain family 10, member A (CLEC10A), transcript variant 2
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA810180 CLEC10A mouse monoclonal antibody,clone OTI2B10 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CLEC10A or NM_006344"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CLEC10A
Synonyms CD301; CLECSF13; CLECSF14; HML; HML2; MGL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC312828 representing NM_006344.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACAAGGACGTATGAAAACTTCCAGTACTTGGAGAATAAGGTGAAAGTCCAGGGGTTTAAAAATGGG
CCACTTCCTCTCCAGTCCCTCCTGCAGCGTCTCTGCTCTGGGCCCTGCCATCTCCTGCTGTCCCTGGGC
CTCGGCCTCCTGCTGCTGGTCATCATCTGTGTGGTTGGATTCCAAAATTCCAAATTTCAGAGGGACCTG
GTGACCCTGAGAACAGATTTTAGCAACTTCACCTCAAACACTGTGGCGGAGATCCAGGCACTGACTTCC
CAGGGCAGCAGCTTGGAAGAAACGATAGCATCTCTGAAAGCTGAGGTGGAGGGTTTCAAGCAGGAACGG
CAGGCAGTTCATTCTGAAATGCTCCTGCGAGTCCAGCAGCTGGTGCAAGACCTGAAGAAACTGACCTGC
CAGGTGGCTACTCTCAACAACAATGGTGAGGAAGCCTCCACTGAAGGGACCTGCTGCCCTGTCAACTGG
GTGGAGCACCAAGACAGCTGCTACTGGTTCTCTCACTCTGGGATGTCCTGGGCCGAGGCTGAGAAGTAC
TGCCAGCTGAAGAACGCCCACCTGGTGGTCATCAACTCCAGGGAGGAGCAGAATTTTGTCCAGAAATAT
CTAGGCTCCGCATACACCTGGATGGGCCTCAGTGACCCTGAAGGAGCCTGGAAGTGGGTGGATGGAACA
GACTATGCGACCGGCTTCCAGAACTGGAAGCCAGGCCAGCCAGACGACTGGCAGGGGCACGGGCTGGGT
GGAGGCGAGGACTGTGCTCACTTCCATCCAGACGGCAGGTGGAATGACGACGTCTGCCAGAGGCCCTAC
CACTGGGTCTGCGAGGCTGGCCTGGGTCAGACCAGCCAGGAGAGTCACTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_006344
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006344.2
RefSeq Size 1716 bp
RefSeq ORF 879 bp
Locus ID 10462
UniProt ID Q8IUN9
Cytogenetics 17p13.1
Domains CLECT, lectin_N
Protein Families Transmembrane
MW 32.9 kDa
Summary This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may function as a cell surface antigen. Two transcript variants encoding distinct isoforms have been identified for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (2), compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_006344" in other vectors (6)
SKU Description Size Price
RC211598 CLEC10A (Myc-DDK-tagged)-Human C-type lectin domain family 10, member A (CLEC10A), transcript variant 2 10 ug
$300.00
RC211598L1 Lenti ORF clone of Human C-type lectin domain family 10, member A (CLEC10A), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC211598L2 Lenti ORF clone of Human C-type lectin domain family 10, member A (CLEC10A), transcript variant 2, mGFP tagged 10 ug
$600.00
RC211598L3 Lenti ORF clone of Human C-type lectin domain family 10, member A (CLEC10A), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC211598L4 Lenti ORF clone of Human C-type lectin domain family 10, member A (CLEC10A), transcript variant 2, mGFP tagged 10 ug
$600.00
RG211598 CLEC10A (tGFP-tagged) - Human C-type lectin domain family 10, member A (CLEC10A), transcript variant 2 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products