OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CDCA7 (NM_031942) Human Untagged Clone

Be the first to review this product
SKU
SC311382
CDCA7 (untagged)-Human cell division cycle associated 7 (CDCA7), transcript variant 1
  $457.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA315887 Rabbit polyclonal anti-CDCA7 antibody
100 ul
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CDCA7 or NM_031942"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CDCA7
Synonyms ICF3; JPO1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_031942 edited
ATGGACGCTCGCCGCGTGCCGCAGAAAGATCTCAGAGTAAAGAAGAACTTAAAGAAATTC
AGATATGTGAAGTTGATTTCCATGGAAACCTCGTCATCCTCTGATGACAGTTGTGACAGC
TTTGCTTCTGATAATTTTGCAAACACGAAACCTAAATTCAGGTCAGATATCAGTGAAGAA
CTGGCAAATGTTTTTTATGAGGACTCTGATAATGAATCTTTCTGCGGCTTTTCAGAAAGT
GAGGTGCAAGATGTATTAGACCATTGTGGATTTTTACAGAAACCAAGGCCAGATGTCACT
AACGAACTGGCCGGTATTTTTCATGCCGACTCTGACGATGAATCATTTTGCGGTTTCTCA
GAGAGTGAGATACAAGATGGAATGAGGCTGCAGTCAGTTCGGGAAGGCTGTAGGACCCGC
AGCCAGTGCAGGCACTCTGGACCTCTCAGGGTGGCGATGAAGTTTCCAGCGCGGAGTACC
AGGGGAGCAACCAACAAAAAAGCAGAGTCCCGCCAGCCCTCAGAGAATTCTGTGACTGAT
TCCAACTCCGATTCAGAAGATGAAAGTGGAATGAATTTTTTGGAGAAAAGGGCTTTAAAT
ATAAAGCAAAACAAAGCAATGCTTGCAAAACTCATGTCTGAATTAGAAAGCTTCCCTGGC
TCGTTCCGTGGAAGACATCCCCTCCCAGGCTCCGACTCACAATCAAGGAGACCGCGAAGG
CGTACATTCCCGGGTGTTGCTTCCAGGAGAAACCCTGAACGGAGAGCTCGTCCTCTTACC
AGGTCAAGGTCCCGGATCCTCGGGTCCCTTGACGCTCTACCCATGGAGGAGGAGGAGGAA
GAGGATAAGTACATGTTGGTGAGAAAGAGGAAGACCGTGGATGGCTACATGAATGAAGAT
GACCTGCCCAGAAGCCGTCGCTCCAGATCATCCGTGACCCTTCCGCATATAATTCGCCCA
GTGGAAGAAATTACAGAGGAGGAGTTGGAGAACGTCTGCAGCAATTCTCGAGAGAAGATA
TATAACCGTTCACTGGGCTCTACTTGTCATCAATGCCGTCAGAAGACTATTGATACCAAA
ACAAACTGCAGAAACCCAGACTGCTGGGGCGTTCGAGGCCAGTTCTGTGGCCCCTGCCTT
CGAAACCGTTATGGTGAAGAGGTCAGGGATGCTCTGCTGGATCCGAACTGGCATTGCCCG
CCTTGTCGAGGAATCTGCAACTGCAGTTTCTGCCGGCAGCGAGATGGACGGTGTGCGACT
GGGGTCCTTGTGTATTTAGCCAAATATCATGGCTTTGGGAATGTGCATGCCTACTTGAAA
AGCCTGAAACAGGAATTTGAAATGCAAGC:A:TAA
Restriction Sites Please inquire |
ACCN NM_031942
Insert Size 2700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_031942.4.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_031942.4, NP_114148.3
RefSeq Size 2839 bp
RefSeq ORF 1353 bp
Locus ID 83879
UniProt ID Q9BWT1
Cytogenetics 2q31.1
Summary This gene was identified as a c-Myc responsive gene, and behaves as a direct c-Myc target gene. Overexpression of this gene is found to enhance the transformation of lymphoblastoid cells, and it complements a transformation-defective Myc Box II mutant, suggesting its involvement in c-Myc-mediated cell transformation. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) encodes the longer isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_031942" in other vectors (6)
SKU Description Size Price
RC216735 CDCA7 (Myc-DDK-tagged)-Human cell division cycle associated 7 (CDCA7), transcript variant 1 10 ug
$457.00
RC216735L1 Lenti ORF clone of Human cell division cycle associated 7 (CDCA7), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC216735L2 Lenti ORF clone of Human cell division cycle associated 7 (CDCA7), transcript variant 1, mGFP tagged 10 ug
$757.00
RC216735L3 Lenti ORF clone of Human cell division cycle associated 7 (CDCA7), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC216735L4 Lenti ORF clone of Human cell division cycle associated 7 (CDCA7), transcript variant 1, mGFP tagged 10 ug
$757.00
RG216735 CDCA7 (tGFP-tagged) - Human cell division cycle associated 7 (CDCA7), transcript variant 1 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products