OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SIRPG (NM_001039508) Human Untagged Clone

Be the first to review this product
SKU
SC310885
SIRPG (untagged)-Human signal-regulatory protein gamma (SIRPG), transcript variant 3
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA315585 Rabbit polyclonal anti-SIRPG antibody
100 ul
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SIRPG or NM_001039508"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SIRPG
Synonyms bA77C3.1; CD172g; SIRP-B2; SIRPB2; SIRPgamma
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310885 representing NM_001039508.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTGTCCCAGCCTCCTGGCCCCATCCTCCTGGTCCTTTCCTGCTTCTGACTCTACTGCTGGGACTT
ACAGAAGTGGCAGGTGAGGAGGAGCTACAGATGATTCAGCCTGAGAAGCTCCTGTTGGTCACAGTTGGA
AAGACAGCCACTCTGCACTGCACTGTGACCTCCCTGCTTCCCGTGGGACCCGTCCTGTGGTTCAGAGGA
GTTGGACCAGGCCGGGAATTAATCTACAATCAAAAAGAAGGCCACTTCCCCAGGGTAACAACAGTTTCA
GACCTCACAAAGAGAAACAACATGGACTTTTCCATCCGCATCAGTAGCATCACCCCAGCAGATGTCGGC
ACATACTACTGTGTGAAGTTTCGAAAAGGGAGCCCTGAGAACGTGGAGTTTAAGTCTGGACCAGGCACT
GAGATGGCTTTGGGTGCCAAACCCTCTGCCCCCGTGGTATTGGGCCCTGCGGCGAGGACCACACCTGAG
CATACAGTGAGTTTCACCTGTGAGTCCCATGGCTTCTCTCCCAGAGACATCACCCTGAAATGGTTCAAA
AATGGGAATGAGCTCTCAGACTTCCAGACCAACGTGGACCCCACAGGACAGAGTGTGGCCTACAGCATC
CGCAGCACAGCCAGGGTGGTACTGGACCCCTGGGACGTTCGCTCTCAGGTCATCTGCGAGGTGGCCCAT
GTCACCTTGCAGGGGGACCCTCTTCGTGGGACTGCCAACTTGTCTGAGGCCATCCGAGGCCCGGCATCA
TCCCTTACTGCGCTGCTCCTCATAGCTGTCCTCCTGGGCCCCATCTACGTCCCCTGGAAGCAGAAGACC
TGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001039508
Insert Size 831 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001039508.1
RefSeq Size 1387 bp
RefSeq ORF 831 bp
Locus ID 55423
UniProt ID Q9P1W8
Cytogenetics 20p13
Protein Families Druggable Genome, Transmembrane
MW 30 kDa
Summary The protein encoded by this gene is a member of the signal-regulatory protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. Alternatively spliced transcript variants encoding different isoforms have been described. provided by RefSeq, Jul 2008
Transcript Variant: This variant (3) lacks an internal segment within the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001039508" in other vectors (4)
SKU Description Size Price
RC215224 SIRPG (Myc-DDK-tagged)-Human signal-regulatory protein gamma (SIRPG), transcript variant 3 10 ug
$300.00
RC215224L3 Lenti ORF clone of Human signal-regulatory protein gamma (SIRPG), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC215224L4 Lenti ORF clone of Human signal-regulatory protein gamma (SIRPG), transcript variant 3, mGFP tagged 10 ug
$600.00
RG215224 SIRPG (tGFP-tagged) - Human signal-regulatory protein gamma (SIRPG), transcript variant 3 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products