OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

BRCC36 (BRCC3) (NM_024332) Human Untagged Clone

Be the first to review this product
SKU
SC310541
BRCC3 (untagged)-Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 1
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA811409 BRCC3 mouse monoclonal antibody,clone OTI6G7 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "BRCC36 or NM_024332"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BRCC36
Synonyms BRCC36; C6.1A; CXorf53
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310541 representing NM_024332.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGTGCAGGTGGTGCAGGCGGTGCAGGCGGTTCATCTCGAGTCTGACGCTTTCCTCGTTTGTCTC
AACCACGCTCTGAGCACAGAGAAGGAGGAAGTAATGGGGCTGTGCATAGGGGAGTTGAACGATGATACA
AGGAGTGACTCCAAATTTGCATATACTGGAACTGAAATGCGCACAGTTGCTGAAAAGGTTGATGCCGTC
AGAATTGTTCACATTCATTCTGTCATCATCTTACGACGTTCTGATAAGAGGAAGGACCGAGTAGAAATT
TCTCCAGAGCAGCTGTCTGCAGCTTCAACAGAGGCAGAGAGGTTGGCTGAACTGACAGGCCGCCCCATG
AGAGTTGTGGGCTGGTATCATTCCCATCCTCATATAACTGTTTGGCCTTCACATGTTGATGTTCGCACA
CAAGCCATGTACCAGATGATGGATCAAGGCTTTGTAGGACTTATTTTTTCCTGTTTCATAGAAGATAAG
AACACAAAGACTGGCCGGGTACTCTACACTTGCTTCCAATCCATACAGGCCCAAAAGAGTTCAGAGTCC
CTTCATGGTCCACGAGACTTCTGGAGCTCCAGCCAGCACATCTCCATTGAGGGCCAGAAGGAAGAGGAA
AGGTATGAGAGAATCGAAATCCCAATCCATATTGTACCTCATGTCACTATCGGGAAAGTGTGCCTTGAA
TCAGCAGTAGAGCTGCCCAAGATCCTGTGCCAGGAGGAGCAGGATGCGTATAGGAGGATCCACAGCCTT
ACACATCTGGACTCAGTAACCAAGATCCATAATGGCTCAGTGTTTACCAAGAATCTGTGCAGTCAGATG
TCGGCAGTCAGCGGGCCTCTCCTACAGTGGTTGGAGGACAGACTGGAGCAAAACCAACAGCATTTGCAG
GAATTACAACAAGAAAAGGAAGAGCTTATGCAAGAACTTTCTTCTCTAGAATAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_024332
Insert Size 951 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024332.3
RefSeq Size 2952 bp
RefSeq ORF 951 bp
Locus ID 79184
UniProt ID P46736
Cytogenetics Xq28
Domains JAB_MPN
Protein Families Druggable Genome, Protease
MW 36.1 kDa
Summary This gene encodes a subunit of the BRCA1-BRCA2-containing complex (BRCC), which is an E3 ubiquitin ligase. This complex plays a role in the DNA damage response, where it is responsible for the stable accumulation of BRCA1 at DNA break sites. The component encoded by this gene can specifically cleave Lys 63-linked polyubiquitin chains, and it regulates the abundance of these polyubiquitin chains in chromatin. The loss of this gene results in abnormal angiogenesis and is associated with syndromic moyamoya, a cerebrovascular angiopathy. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. provided by RefSeq, Jun 2011
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_024332" in other vectors (6)
SKU Description Size Price
RC200727 BRCC3 (Myc-DDK-tagged)-Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 1 10 ug
$300.00
RC200727L1 Lenti ORF clone of Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200727L2 Lenti ORF clone of Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 1, mGFP tagged 10 ug
$600.00
RC200727L3 Lenti ORF clone of Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC200727L4 Lenti ORF clone of Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 1, mGFP tagged 10 ug
$600.00
RG200727 BRCC3 (tGFP-tagged) - Human BRCA1/BRCA2-containing complex, subunit 3 (BRCC3), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products