OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

LIMS2 (NM_017980) Human Untagged Clone

Be the first to review this product
SKU
SC310488
LIMS2 (untagged)-Human LIM and senescent cell antigen-like domains 2 (LIMS2), transcript variant 2
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA811408 LIMS2 mouse monoclonal antibody,clone OTI5H8 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "LIMS2 or NM_017980"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LIMS2
Synonyms LGMD2W; MDRCMTT; PINCH-2; PINCH2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310488 representing NM_017980.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCCCGGCTGGGTGCGCTGGCCGCGTCGGGGCTGTACCGGCGGCGCCAGCACCGGCAGAGCCCG
CCGCCAGCCACGGGCAATATGTCGGACGCCTTGGCCAACGCCGTGTGCCAGCGCTGCCAGGCCCGCTTC
TCCCCCGCCGAGCGCATTGTCAACAGCAATGGGGAGCTGTACCATGAGCACTGCTTCGTGTGTGCCCAG
TGCTTCCGGCCCTTCCCCGAGGGGCTCTTCTATGAGTTTGAAGGCCGGAAGTACTGCGAACACGACTTC
CAAATGCTGTTTGCTCCGTGCTGTGGATCCTGCGGTGAGTTCATCATTGGCCGCGTCATCAAGGCCATG
AACAACAACTGGCACCCGGGCTGCTTCCGCTGCGAGCTGTGTGATGTGGAGCTGGCTGACCTGGGCTTT
GTGAAGAATGCCGGCAGGCATCTCTGCCGGCCTTGCCACAACCGTGAGAAGGCCAAGGGCCTGGGCAAG
TACATCTGCCAGCGGTGCCACCTGGTCATCGACGAGCAGCCCCTCATGTTCAGGAGCGACGCCTACCAC
CCTGACCACTTCAACTGCACCCACTGTGGGAAGGAGCTGACAGCCGAGGCCCGCGAGCTGAAGGGTGAG
CTCTACTGCCTGCCCTGCCATGACAAGATGGGCGTCCCCATCTGCGGGGCCTGCCGCCGGCCCATCGAG
GGCCGAGTGGTCAACGCGCTGGGCAAGCAGTGGCACGTGGAGCACTTTGTCTGTGCCAAGTGTGAGAAG
CCATTCCTGGGGCACCGGCACTATGAGAAGAAGGGCCTGGCCTACTGCGAGACTCACTACAACCAGCTC
TTCGGGGACGTCTGCTACAACTGCAGCCATGTGATTGAAGGCGATGTGGTGTCGGCCCTCAACAAGGCC
TGGTGTGTGAGCTGCTTCTCCTGCTCCACCTGCAACAGCAAGCTCACCCTGAAGAACAAGTTTGTGGAG
TTCGACATGAAGCCCGTGTGTAAGAGGTGCTACGAGAAGTTCCCGCTGGAGCTGAAGAAGCGGCTGAAG
AAGCTGTCGGAGCTGACCTCCCGCAAGGCCCAGCCCAAGGCCACAGACCTCAACTCTGCCTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_017980
Insert Size 1098 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_017980.4
RefSeq Size 2173 bp
RefSeq ORF 1098 bp
Locus ID 55679
UniProt ID Q7Z4I7
Cytogenetics 2q14.3
Domains LIM
MW 41.5 kDa
Summary This gene encodes a member of a small family of focal adhesion proteins which interacts with ILK (integrin-linked kinase), a protein which effects protein-protein interactions with the extraceullar matrix. The encoded protein has five LIM domains, each domain forming two zinc fingers, which permit interactions which regulate cell shape and migration. A pseudogene of this gene is located on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Nov 2011
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is longer than isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_017980" in other vectors (4)
SKU Description Size Price
RC213746 LIMS2 (Myc-DDK-tagged)-Human LIM and senescent cell antigen-like domains 2 (LIMS2), transcript variant 2 10 ug
$457.00
RC213746L3 Lenti ORF clone of Human LIM and senescent cell antigen-like domains 2 (LIMS2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC213746L4 Lenti ORF clone of Human LIM and senescent cell antigen-like domains 2 (LIMS2), transcript variant 2, mGFP tagged 10 ug
$757.00
RG213746 LIMS2 (tGFP-tagged) - Human LIM and senescent cell antigen-like domains 2 (LIMS2), transcript variant 2 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products