OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PLAG1 (NM_002655) Human Untagged Clone

Be the first to review this product
SKU
SC310316
PLAG1 (untagged)-Human pleiomorphic adenoma gene 1 (PLAG1), transcript variant 1
  $513.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA367737 PLAG1 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PLAG1 or NM_002655"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PLAG1
Synonyms PSA; SGPA; SRS4; ZNF912
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC310316 representing NM_002655.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCACTGTCATTCCTGGTGATTTGTCAGAAGTAAGAGATACCCAGAAAGTCCCTTCAGGGAAACGT
AAGCGTGGTGAAACCAAACCAAGAAAAAACTTTCCTTGCCAACTGTGTGACAAGGCCTTTAACAGTGTT
GAGAAATTAAAGGTTCACTCCTACTCTCACACAGGAGAGAGGCCCTACAAGTGCATACAACAAGACTGC
ACCAAGGCCTTTGTTTCTAAGTACAAATTACAAAGGCACATGGCTACTCATTCTCCTGAGAAAACCCAC
AAGTGTAATTATTGTGAGAAAATGTTTCACCGGAAAGATCATCTGAAGAATCACCTCCATACACACGAC
CCTAACAAAGAGACGTTTAAGTGCGAAGAATGTGGCAAGAACTACAATACCAAGCTTGGATTTAAACGT
CACTTGGCCTTGCATGCCGCAACAAGTGGTGACCTCACCTGTAAGGTATGTTTGCAAACTTTTGAAAGC
ACGGGAGTGCTTCTGGAGCACCTTAAATCTCATGCAGGCAAGTCGTCTGGTGGGGTTAAAGAAAAAAAG
CACCAGTGCGAACATTGTGATCGCCGGTTCTACACCCGAAAGGATGTCCGGAGACACATGGTGGTGCAC
ACTGGAAGAAAGGACTTCCTCTGTCAGTATTGTGCACAGAGATTTGGGCGAAAGGATCACCTGACTCGA
CATATGAAGAAGAGTCACAATCAAGAGCTTCTGAAGGTCAAAACAGAACCAGTGGATTTCCTTGACCCA
TTTACCTGCAATGTGTCTGTGCCTATAAAAGACGAGCTCCTTCCGGTGATGTCCTTACCTTCCAGTGAA
CTGTTATCAAAGCCATTCACAAACACTTTGCAGTTAAACCTCTACAACACTCCATTTCAGTCCATGCAG
AGCTCGGGATCTGCCCACCAAATGATCACAACTTTACCTTTGGGAATGACATGCCCAATAGATATGGAC
ACTGTTCATCCCTCTCACCACCTTTCTTTCAAATATCCGTTCAGTTCTACCTCATATGCAATTTCTATT
CCTGAAAAAGAACAGCCATTAAAGGGGGAAATTGAGAGTTACCTGATGGAGTTACAAGGTGGCGTGCCC
TCTTCATCCCAAGATTCTCAAGCATCGTCATCATCTAAGCTAGGGTTGGATCCTCAGATTGGGTCCCTA
GATGATGGTGCAGGAGACCTCTCCCTATCCAAAAGCTCTATCTCCATCAGTGACCCCCTAAACACACCA
GCATTGGATTTTTCTCAGTTGTTTAATTTCATACCTTTAAATGGTCCTCCCTATAATCCTCTATCAGTG
GGGAGCCTTGGAATGAGCTATTCCCAGGAAGAAGCACATTCTTCTGTTTCCCAGCTCCCCCCACAAACA
CAGGATCTTCAGGATCCTGCAAACACTATAGGGCTTGGGTCTCTGCACTCACTGTCAGCAGCTTTCACC
AGCAGTTTAAGCACAAGTACCACCCTCCCACGTTTCCATCAAGCTTTTCAGTAG
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_002655
Insert Size 1503 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002655.2
RefSeq Size 7338 bp
RefSeq ORF 1503 bp
Locus ID 5324
UniProt ID Q6DJT9
Cytogenetics 8q12.1
Domains zf-C2H2
Protein Families Transcription Factors
MW 55.9 kDa
Summary Pleomorphic adenoma gene 1 encodes a zinc finger protein with 2 putative nuclear localization signals. PLAG1, which is developmentally regulated, has been shown to be consistently rearranged in pleomorphic adenomas of the salivary glands. PLAG1 is activated by the reciprocal chromosomal translocations involving 8q12 in a subset of salivary gland pleomorphic adenomas. Three transcript variants encoding two different isoforms have been found for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002655" in other vectors (6)
SKU Description Size Price
RC216628 PLAG1 (Myc-DDK-tagged)-Human pleiomorphic adenoma gene 1 (PLAG1), transcript variant 1 10 ug
$457.00
RC216628L1 Lenti ORF clone of Human pleiomorphic adenoma gene 1 (PLAG1), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC216628L2 Lenti ORF clone of Human pleiomorphic adenoma gene 1 (PLAG1), transcript variant 1, mGFP tagged 10 ug
$757.00
RC216628L3 Lenti ORF clone of Human pleiomorphic adenoma gene 1 (PLAG1), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC216628L4 Lenti ORF clone of Human pleiomorphic adenoma gene 1 (PLAG1), transcript variant 1, mGFP tagged 10 ug
$757.00
RG216628 PLAG1 (tGFP-tagged) - Human pleiomorphic adenoma gene 1 (PLAG1), transcript variant 1 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products