OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SP6 (NM_199262) Human Untagged Clone

Be the first to review this product
SKU
SC307917
SP6 (untagged)-Human Sp6 transcription factor (SP6)
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA339841 Rabbit Polyclonal Anti-SP6 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SP6 or NM_199262"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SP6
Synonyms EPFN; EPIPROFIN; KLF14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307917 representing NM_199262.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTAACCGCTGTCTGCGGCTCTCTGGGCAGCCAGCACACGGAAGCGCCGCACGCCTCCCCGCCGCGC
CTCGACCTGCAGCCTCTCCAAACTTACCAGGGCCACACGAGCCCTGAGGCCGGGGACTACCCCTCCCCG
CTGCAGCCTGGAGAGCTGCAGAGCCTCCCGCTGGGCCCGGAGGTGGACTTCTCGCAGGGCTATGAGCTG
CCAGGGGCCTCCTCGCGGGTAACCTGCGAGGACCTGGAAAGCGACAGTCCCTTGGCCCCGGGCCCCTTT
TCCAAGCTCCTGCAGCCGGACATGTCACACCATTATGAATCGTGGTTCAGGCCGACTCACCCAGGCGCG
GAGGATGGCTCGTGGTGGGACCTTCATCCGGGCACCAGCTGGATGGACCTCCCCCACACTCAGGGCGCG
CTGACCTCACCTGGCCACCCGGGGGCGCTTCAGGCGGGCTTGGGGGGCTACGTCGGAGACCACCAGCTT
TGTGCCCCGCCACCCCACCCGCATGCGCACCACCTCCTTCCAGCTGCCGGAGGGCAGCATCTCCTAGGG
CCGCCCGACGGGGCTAAGGCCTTGGAAGTAGCCGCCCCGGAGTCTCAAGGGCTGGATTCCAGCCTGGAC
GGGGCGGCGCGTCCCAAAGGCTCCCGGCGGTCGGTGCCCCGCAGCTCAGGCCAGACCGTCTGTCGCTGC
CCCAACTGTCTGGAGGCGGAGCGACTGGGGGCTCCATGTGGGCCCGATGGGGGCAAGAAGAAGCATTTG
CACAACTGCCACATCCCGGGCTGCGGGAAAGCCTACGCCAAGACGTCGCACCTGAAGGCGCACCTGCGC
TGGCACAGCGGCGACCGTCCCTTCGTGTGCAACTGGCTCTTCTGCGGCAAGCGCTTCACGCGCTCGGAC
GAGCTGCAGCGCCACCTCCAGACCCACACCGGCACCAAGAAGTTCCCCTGTGCAGTCTGCAGCCGCGTC
TTCATGCGCAGCGACCACCTGGCCAAGCACATGAAAACCCACGAGGGCGCCAAGGAGGAGGCGGCTGGG
GCGGCCTCGGGAGAGGGCAAGGCCGGCGGCGCAGTGGAGCCCCCCGGGGGCAAAGGCAAACGCGAGGCC
GAGGGCAGCGTGGCTCCCTCCAACTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_199262
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_199262.2
RefSeq Size 3794 bp
RefSeq ORF 1131 bp
Locus ID 80320
UniProt ID Q3SY56
Cytogenetics 17q21.32
Protein Families Transcription Factors
MW 39.8 kDa
Summary SP6 belongs to a family of transcription factors that contain 3 classical zinc finger DNA-binding domains consisting of a zinc atom tetrahedrally coordinated by 2 cysteines and 2 histidines (C2H2 motif). These transcription factors bind to GC-rich sequences and related GT and CACCC boxes (Scohy et al., 2000 PubMed 11087666).supplied by OMIM, Mar 2008
Transcript Variant: This variant (2) differs in the 5' UTR and represents the use of an alternate promoter, compared to variant 1. Variants 1 and 2 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_199262" in other vectors (6)
SKU Description Size Price
RC219213 SP6 (Myc-DDK-tagged)-Human Sp6 transcription factor (SP6) 10 ug
$457.00
RC219213L1 Lenti ORF clone of Human Sp6 transcription factor (SP6), Myc-DDK-tagged 10 ug
$757.00
RC219213L2 Lenti ORF clone of Human Sp6 transcription factor (SP6), mGFP tagged 10 ug
$757.00
RC219213L3 Lenti ORF clone of Human Sp6 transcription factor (SP6), Myc-DDK-tagged 10 ug
$757.00
RC219213L4 Lenti ORF clone of Human Sp6 transcription factor (SP6), mGFP tagged 10 ug
$757.00
RG219213 SP6 (tGFP-tagged) - Human Sp6 transcription factor (SP6) 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products