OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MAP1D (METAP1D) (NM_199227) Human Untagged Clone

Be the first to review this product
SKU
SC307902
METAP1D (untagged)-Human methionyl aminopeptidase type 1D (mitochondrial) (METAP1D), nuclear gene encoding mitochondrial protein
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MAP1D or NM_199227"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAP1D
Synonyms MAP 1D; MAP1D; MetAP 1D; Metap1l
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307902 representing NM_199227.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCGCCCAGTGGCGTCCACCTGCTCGTCCGCAGAGGTTCTCATAGAATTTTCTCTTCACCACTC
AATCATATCTACTTACACAAGCAGTCAAGCAGTCAACAAAGAAGAAATTTCTTTTTTCGGAGACAAAGA
GATATTTCACACAGTATAGTTTTGCCGGCTGCAGTTTCTTCAGCTCATCCGGTTCCTAAGCACATAAAG
AAGCCAGACTATGTGACGACAGGCATTGTACCAGACTGGGGAGACAGCATAGAAGTTAAGAATGAAGAT
CAGATTCAAGGGCTTCATCAGGCTTGTCAGCTGGCCCGCCACGTCCTCCTCTTGGCTGGGAAGAGTTTA
AAGGTTGACATGACAACTGAAGAGATAGATGCTCTTGTTCATCGGGAAATCATCAGTCATAATGCCTAT
CCCTCACCTCTAGGCTATGGAGGTTTTCCAAAATCTGTTTGTACCTCTGTAAACAACGTGCTCTGTCAT
GGTATTCCTGACAGTCGACCTCTTCAGGATGGAGATATTATCAACATTGATGTCACAGTCTATTACAAT
GGCTACCATGGAGACACCTCTGAAACATTTTTGGTGGGCAATGTGGACGAATGTGGTAAAAAGTTAGTG
GAGGTTGCCAGGAGGTGTAGAGATGAAGCAATTGCAGCTTGCAGAGCAGGGGCTCCCTTCTCTGTAATT
GGAAACACAATCAGCCACATAACTCATCAGAATGGTTTTCAAGTCTGTCCACATTTTGTGGGACATGGA
ATAGGATCTTACTTTCATGGACATCCAGAAATTTGGCATCATGCAAACGACAGTGATCTACCCATGGAG
GAGGGCATGGCATTCACTATAGAGCCAATCATCACGGAGGGATCCCCTGAATTTAAAGTCCTGGAGGAT
GCATGGACTGTGGTCTCCCTAGACAATCAAAGGTCGGCGCAGTTCGAGCACACGGTTCTGATCACGTCG
AGGGGCGCGCAGATCCTGACCAAACTACCCCATGAGGCCTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_199227
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_199227.1
RefSeq Size 1550 bp
RefSeq ORF 1008 bp
Locus ID 254042
UniProt ID Q6UB28
Cytogenetics 2q31.1
Protein Families Druggable Genome
MW 37.1 kDa
Summary The N-terminal methionine excision pathway is an essential process in which the N-terminal methionine is removed from many proteins, thus facilitating subsequent protein modification. In mitochondria, enzymes that catalyze this reaction are celled methionine aminopeptidases (MetAps, or MAPs; EC 3.4.11.18) (Serero et al., 2003 PubMed 14532271).supplied by OMIM, Mar 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_199227" in other vectors (4)
SKU Description Size Price
RC220687 METAP1D (Myc-DDK-tagged)-Human methionyl aminopeptidase type 1D (mitochondrial) (METAP1D), nuclear gene encoding mitochondrial protein 10 ug
$457.00
RC220687L3 Lenti ORF clone of Human methionyl aminopeptidase type 1D (mitochondrial) (METAP1D), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged 10 ug
$757.00
RC220687L4 Lenti ORF clone of Human methionyl aminopeptidase type 1D (mitochondrial) (METAP1D), nuclear gene encoding mitochondrial protein, mGFP tagged 10 ug
$757.00
RG220687 METAP1D (tGFP-tagged) - Human methionyl aminopeptidase type 1D (mitochondrial) (METAP1D), nuclear gene encoding mitochondrial protein 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products