OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

THAP1 (NM_199003) Human Untagged Clone

Be the first to review this product
SKU
SC307848
THAP1 (untagged)-Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2
  $165.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "THAP1 or NM_199003"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol THAP1
Synonyms DYT6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307848 representing NM_199003.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGCAGTCCTGCTCCGCCTACGGCTGCAAGAACCGCTACGACAAGGACAAGCCCGTTTCTTTCCAC
AAAAAGAAGATCTTCTGGAGCCACAGGAACAGCTTCCCCCACCTCCTTTACCGCCTCCTGTTTCCCAGG
TTGATGCTGCTATTGGATTACTAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_199003
Insert Size 162 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_199003.1
RefSeq Size 1993 bp
RefSeq ORF 162 bp
Locus ID 55145
UniProt ID Q9NVV9
Cytogenetics 8p11.21
MW 6.5 kDa
Summary The protein encoded by this gene contains a THAP domain, a conserved DNA-binding domain. This protein colocalizes with the apoptosis response protein PAWR/PAR-4 in promyelocytic leukemia (PML) nuclear bodies, and functions as a proapoptotic factor that links PAWR to PML nuclear bodies. Alternatively spliced transcript variants encoding distinct isoforms have been observed. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) lacks a coding exon compared to variant 1, which causes a frameshift. The resulting isoform (2) has a distinct and shorter C-terminus, as compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_199003" in other vectors (6)
SKU Description Size Price
RC222957 THAP1 (Myc-DDK-tagged)-Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2 10 ug
$150.00
RC222957L1 Lenti ORF clone of Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC222957L2 Lenti ORF clone of Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2, mGFP tagged 10 ug
$450.00
RC222957L3 Lenti ORF clone of Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC222957L4 Lenti ORF clone of Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2, mGFP tagged 10 ug
$450.00
RG222957 THAP1 (tGFP-tagged) - Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2 10 ug
$350.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products