OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

B3GNT8 (NM_198540) Human Untagged Clone

Be the first to review this product
SKU
SC307743
B3GNT8 (untagged)-Human UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 (B3GNT8)
  $732.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "B3GNT8 or NM_198540"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol B3GNT8
Synonyms B3GALT7; beta3Gn-T8; BGALT15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307743 representing NM_198540.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCTGCCCCAAGTGCCTTCTCTGCCTGTCAGCACTGCTCACACTCCTGGGCCTCAAAGTGTACATC
GAGTGGACATCCGAGTCCCGGCTCAGCAAGGCCTACCCCAGCCCTCGGGGCACCCCGCCAAGCCCCACG
CCAGCCAACCCTGAGCCCACCCTACCTGCCAACCTCTCCACCCGCCTGGGCCAGACTATCCCGCTGCCC
TTTGCTTACTGGAACCAGCAGCAGTGGCGGCTGGGGTCCCTGCCCAGTGGGGACAGCACTGAAACGGGG
GGCTGCCAGGCTTGGGGGGCCGCCGCCGCCACCGAGATCCCTGACTTCGCCTCCTACCCCAAGGACCTC
CGCCGCTTCTTGCTGTCAGCAGCCTGCCGGAGCTTCCCACAGTGGCTGCCTGGAGGTGGTGGCAGCCAA
GTCTCCAGCTGCTCAGATACTGATGTCCCCTACCTGCTGTTGGCCGTCAAGTCAGAACCAGGGCGCTTT
GCAGAACGACAGGCCGTGAGAGAGACGTGGGGCAGTCCAGCTCCAGGGATCCGGCTGCTCTTCCTGCTA
GGGTCTCCGGTGGGTGAGGCGGGGCCTGACCTAGACTCACTAGTGGCCTGGGAGAGCCGTCGCTACAGT
GACCTGCTGCTCTGGGACTTCCTCGACGTCCCATTCAACCAGACGCTCAAAGACCTGCTGCTGCTGGCC
TGGCTGGGCCGCCACTGCCCCACCGTGAGTTTTGTCTTGCGAGCTCAGGACGATGCCTTTGTACACACC
CCTGCCCTGCTGGCTCACCTGCGGGCCCTGCCACCTGCCTCGGCCCGAAGCCTCTACCTGGGTGAGGTC
TTTACCCAGGCCATGCCTCTCCGGAAGCCAGGAGGACCCTTCTATGTGCCCGAGTCCTTCTTCGAAGGT
GGCTACCCAGCCTATGCAAGCGGGGGTGGCTACGTCATTGCCGGGCGCCTGGCACCCTGGCTGCTGCGG
GCGGCAGCCCGTGTGGCACCCTTCCCCTTTGAGGACGTCTACACTGGCCTTTGCATCCGAGCCCTGGGC
CTGGTGCCCCAGGCCCACCCAGGCTTCCTCACAGCCTGGCCAGCAGACCGCACTGCGGACCACTGTGCT
TTCCGCAACCTGCTGCTGGTACGGCCCCTGGGCCCCCAGGCCAGCATTCGGCTCTGGAAACAACTGCAA
GACCCAAGGCTCCAGTGCTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_198540
Insert Size 1194 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198540.2
RefSeq Size 1894 bp
RefSeq ORF 1194 bp
Locus ID 374907
UniProt ID Q7Z7M8
Cytogenetics 19q13.2
MW 43.4 kDa
Summary Beta-1,3-N-acetylglucosaminyltransferase that plays a role in the elongation of specific branch structures of multiantennary N-glycans. Has strong activity towards tetraantennary N-glycans and 2,6 triantennary glycans.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_198540" in other vectors (4)
SKU Description Size Price
RC221160 B3GNT8 (Myc-DDK-tagged)-Human UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 (B3GNT8) 10 ug
$686.00
RC221160L3 Lenti ORF clone of Human UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 (B3GNT8), Myc-DDK-tagged 10 ug
$986.00
RC221160L4 Lenti ORF clone of Human UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 (B3GNT8), mGFP tagged 10 ug
$986.00
RG221160 B3GNT8 (tGFP-tagged) - Human UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 (B3GNT8) 10 ug
$886.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products