OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SPDYA (NM_182756) Human Untagged Clone

Be the first to review this product
SKU
SC307504
SPDYA (untagged)-Human speedy homolog A (Xenopus laevis) (SPDYA), transcript variant 1
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SPDYA or NM_182756"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SPDYA
Synonyms RINGO3; RINGOA; SPDY1; SPY1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307504 representing NM_182756.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGCACAATCAGATGTGTTGTGAGACACCACCTACTGTCACTGTTTATGTAAAATCAGGGTCAAAT
AGATCACATCAGCCTAAAAAGCCCATTACTCTGAAGCGTCCTATTTGTAAAGATAATTGGCAAGCATTT
GAAAAAAATACACATAATAACAACAAATCTAAACGCCCCAAAGGACCTTGTCTGGTTATACAGCGTCAG
GATATGACTGCTTTCTTTAAATTATTTGATGACGATTTAATTCAAGATTTCTTGTGGATGGACTGCTGC
TGTAAAATTGCAGACAAGTATCTTTTGGCTATGACCTTTGTTTATTTCAAGAGGGCTAAATTTACTATA
AGTGAGCATACCAGGATAAATTTCTTTATTGCTCTGTATCTGGCTAATACAGTTGAAGAAGATGAAGAA
GAAACCAAGTACGAAATTTTTCCATGGGCTTTAGGGAAAAACTGGAGAAAATTGTTCCCTAATTTCTTA
AAGTTAAGGGACCAGCTCTGGGATAGAATTGACTATAGGGCTATTGTAAGCAGGCGATGTTGTGAGGAG
GTTATGGCCATTGCACCAACCCATTATATCTGGCAAAGAGAACGTTCTGTTCATCACAGTGGAGCTGTC
AGAAACTACAACAGAGATGAAGTTCAGCTGCCCCGGGGACCTAGTGCCACACCAGTAGATTGTTCACTC
TGTGGTAAAAAAAGAAGATATGTTAGACTGGGATTGTCTTCATCATCATCTTTATCCAGTCATACAGCA
GGGGTGACAGAAAAACATTCTCAGGACTCATACAACTCACTGTCAATGGACATAATAGGTGATCCTTCT
CAAGCTTATACTGGTTCTGAAGTAGTCAATGACCATCAATCAAATAAAGGAAAGAAAACTAATTTCTTG
AAGAAAGACAAATCTATGGAGTGGTTTACAGGAAGTGAAGAATGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_182756
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_182756.3
RefSeq Size 1830 bp
RefSeq ORF 942 bp
Locus ID 245711
UniProt ID Q5MJ70
Cytogenetics 2p23.2
Protein Pathways Oocyte meiosis, Progesterone-mediated oocyte maturation
MW 36.5 kDa
Summary Regulates the G1/S phase transition of the cell cycle by binding and activating CDK1 and CDK2 (PubMed:12972555). Contributes to CDK2 activation without promoting CDK2 phosphorylation, by inducing a conformation change of the CDK2 T-loop that obstructs the substrate-binding cleft prior to kinase activation (PubMed:28666995). Mediates cell survival during the DNA damage process through activation of CDK2 (PubMed:12839962).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) lacks a segment in the 5' UTR, compared to variant 3. Variants 1 and 3 both encode the longer protein (isoform 1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_182756" in other vectors (6)
SKU Description Size Price
RC210559 SPDYA (Myc-DDK-tagged)-Human speedy homolog A (Xenopus laevis) (SPDYA), transcript variant 1 10 ug
$300.00
RC210559L1 Lenti ORF clone of Human speedy homolog A (Xenopus laevis) (SPDYA), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC210559L2 Lenti ORF clone of Human speedy homolog A (Xenopus laevis) (SPDYA), transcript variant 1, mGFP tagged 10 ug
$600.00
RC210559L3 Lenti ORF clone of Human speedy homolog A (Xenopus laevis) (SPDYA), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC210559L4 Lenti ORF clone of Human speedy homolog A (Xenopus laevis) (SPDYA), transcript variant 1, mGFP tagged 10 ug
$600.00
RG210559 SPDYA (tGFP-tagged) - Human speedy homolog A (Xenopus laevis) (SPDYA), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products