OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

LILRA5 (NM_181986) Human Untagged Clone

Be the first to review this product
SKU
SC307398
LILRA5 (untagged)-Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 (LILRA5), transcript variant 4
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA333401 Rabbit Polyclonal Anti-LILRA5 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "LILRA5 or NM_181986"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LILRA5
Synonyms CD85; CD85F; ILT-11; ILT11; LILRB7; LIR-9; LIR9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC307398 representing NM_181986.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCACCATGGTCTCATCCATCTGCACAGCTGCAGCCAGTGGGAGGAGACGCCGTGAGCCCTGCCCTC
ATGGTTCTGCTCTGCCTCGGGAACCTCTCCAAAGCCACCCTCTGGGCTGAGCCAGGCTCTGTGATCAGC
CGGGGGAACTCTGTGACCATCCGGTGTCAGGGGACCCTGGAGGCCCAGGAATACCGTCTGGTTAAAGAG
GGAAGCCCAGAACCCTGGGACACACAGAACCCACTGGAGCCCAAGAACAAGGCCAGATTCTCCATCCCA
TCCATGACAGAGCACCATGCAGGGAGATACCGCTGTTACTACTACAGCCCTGCAGGCTGGTCAGAGCCC
AGCGACCCCCTGGAGCTGGTGGTGACAGGATTCTACAACAAACCCACCCTCTCAGCCCTGCCCAGTCCT
GTGGTGACCTCAGGAGAGAACGTGACCCTCCAGTGTGGCTCACGGCTGAGATTCGACAGGTTCATTCTG
ACTGAGGAAGGAGACCACAAGCTCTCCTGGACCTTGGACTCACAGCTGACCCCCAGTGGGCAGTTCCAG
GCCCTGTTCCCTGTGGGCCCTGTGACCCCCAGCCACAGGTGGATGCTCAGATGCTATGGCTCTCGCAGG
CATATCCTGCAGGTATGGTCAGAACCCAGTGACCTCCTGGAGATTCCGGTCTCAGGTGAGGAAGCCACA
GTCTTCTCTAGTACAATTCAGGGAAGCCAGACAGGTTGTGGAGAGCTTTACAGGCAGGGCAGCCCCTGC
TAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_181986
Insert Size 762 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181986.2
RefSeq Size 1045 bp
RefSeq ORF 762 bp
Locus ID 353514
UniProt ID A6NI73
Cytogenetics 19q13.42
MW 27.9 kDa
Summary The protein encoded by this gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LIR family members are known to have activating and inibitory functions in leukocytes. Crosslink of this receptor protein on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses. This gene is one of the leukocyte receptor genes that form a gene cluster on the chromosomal region 19q13.4. Four alternatively spliced transcript variants encoding distinct isoforms have been described. provided by RefSeq, Jul 2008
Transcript Variant: This variant (4), also known as LIR9s2, lacks an in-frame coding segment and differs in the 3' end-region, as compared to variant 1. The resulting isoform (4) lacks an internal region and has a distinct and shorter C-terminus as compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_181986" in other vectors (4)
SKU Description Size Price
RC221278 LILRA5 (Myc-DDK-tagged)-Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 (LILRA5), transcript variant 4 10 ug
$300.00
RC221278L3 Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 (LILRA5), transcript variant 4, Myc-DDK-tagged 10 ug
$600.00
RC221278L4 Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 (LILRA5), transcript variant 4, mGFP tagged 10 ug
$600.00
RG221278 LILRA5 (tGFP-tagged) - Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 (LILRA5), transcript variant 4 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products