OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PNPLA1 (NM_173676) Human Untagged Clone

Be the first to review this product
SKU
SC306910
PNPLA1 (untagged)-Human patatin-like phospholipase domain containing 1 (PNPLA1), transcript variant 1
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA330996 Rabbit polyclonal Anti-PNPLA1 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PNPLA1 or NM_173676"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PNPLA1
Synonyms ARCI10; dJ50J22.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC306910 representing NM_173676.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGCAGATGATGAGGCAGTTTCTGTACCGGGTCCTGCCCGAGGACTCCTACAAGGTCACCACGGGG
AAGCTCCATGTGAGCCTCACCCGCTTAACGGACGGGGAGAATGTGGTGGTTTCAGAGTTCACGTCCAAG
GAGGAGCTCATTGAGGCCCTATACTGCAGCTGCTTCGTCCCGGTGTACTGTGGCCTCATCCCCCCGACT
TACCGCGGTGTGAGGTACATCGATGGGGGCTTCACGGGCATGCAGCCCTGTGCCTTCTGGACCGACGCC
ATCACCATCTCCACCTTCAGTGGGCAGCAGGACATCTGTCCCCGGGACTGCCCGGCCATCTTCCACGAC
TTCCGCATGTTCAACTGCTCCTTCCAGTTCTCCCTGGAGAACATCGCCAGGATGACCCACGCATTGTTC
CCCCCGGACCTGGTGATCCTGCACGATTACTACTACCGAGGGTACGAGGATGCAGTTTTGTACTTGAGG
CGGCTGAATGCTGTTTATCTTAATTCTTCCTCCAAGAGAGTGATTTTCCCCCGGGTGGAAGTGTACTGC
CAGATAGAACTCGCCCTTGGCAATGAGTGCCCTGAACGCAGTCAACCAAGCCTTCGAGCACGGCAGGCC
AGTCTGGAAGGAGCCACACAACCTCACAAGGAGTGGGTTCCCAAAGGGGATGGAAGGGGCAGCCATGGT
CCGCCTGTGTCCCAACCTGTGCAGACACTTGAATTCACATGCGAGTCACCTGTTTCAGCACCAGTCTCT
CCACTTGAGCAGCCACCTGCACAGCCACTGGCCTCTTCAACTCCACTTTCTCTAAGTGGCATGCCACCT
GTATCATTCCCAGCTGTGCACAAGCCACCCAGCTCCACACCTGGTTCATCACTGCCCACCCCACCACCT
GGACTGTCACCTCTGTCACCTCAGCAGCAGGTACAACCGTCTGGATCACCAGCCAGATCCCTACACTCT
CAGGCACCCACTTCACCCAGGCCATCCCTGGGGCCTTCAACTGTGGGGGCACCTCAAACACTGCCCCGA
AGTTCTCTTTCAGCCTTCCCTGCTCAGCCACCTGTGGAGGAACTAGGCCAAGAACAGCCCCAAGCTGTA
GCTCTTCTTGTCTCTTCAAAACCAAAAAGCGCCGTGCCTCTGGTTCATGTGAAGGAAACCGTCAGCAAG
CCTTATGTAACGGAGAGCCCTGCTGAAGACTCAAACTGGGTGAATAAGGTCTTCAAGAAGAACAAGCAA
AAGACAAGTGGCACCAGAAAAGGCTTCCCAAGACATTCGGGATCCAAAAAACCAAGCAGCAAAGTGCAG
TGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_173676
Insert Size 1314 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_173676.2
RefSeq Size 2367 bp
RefSeq ORF 1314 bp
Locus ID 285848
UniProt ID Q8N8W4
Cytogenetics 6p21.31
MW 47.8 kDa
Summary The protein encoded by this gene belongs to the patatin-like phospholipase (PNPLA) family, which is characterized by the presence of a highly conserved patatin domain. PNPLA family members have diverse lipolytic and acyltransferase activities, and are key elements in lipid metabolism. While other members of this family have been well characterized, the function of this gene remained an enigma. However, recent studies show that this gene is expressed in the skin epidermal keratinocytes, and has a role in glycerophospholipid metabolism in the cutaneous barrier. Consistent with these observations, mutations in this gene are associated with ichthyosis in human (autosomal recessive congenital ichthyoses, ARCI) and dog. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jun 2012
Transcript Variant: This variant (1) encodes the shortest isoform (1), which lacks the N-terminal catalytic patatin domain, and thought unlikely to function as a lipolytic enzyme (PMID:16799181).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_173676" in other vectors (4)
SKU Description Size Price
RC218871 PNPLA1 (Myc-DDK-tagged)-Human patatin-like phospholipase domain containing 1 (PNPLA1), transcript variant 1 10 ug
$457.00
RC218871L3 Lenti ORF clone of Human patatin-like phospholipase domain containing 1 (PNPLA1), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC218871L4 Lenti ORF clone of Human patatin-like phospholipase domain containing 1 (PNPLA1), transcript variant 1, mGFP tagged 10 ug
$757.00
RG218871 PNPLA1 (tGFP-tagged) - Human patatin-like phospholipase domain containing 1 (PNPLA1), transcript variant 1 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products