OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

B4GALNT2 (NM_153446) Human Untagged Clone

Be the first to review this product
SKU
SC306607
B4GALNT2 (untagged)-Human beta-1,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2), transcript variant 1
  $844.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "B4GALNT2 or NM_153446"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol B4GALNT2
Synonyms B4GALT; GALGT2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC306607 representing NM_153446.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGAGCGCTGGCTTTTCCGTGGGAAAATTCCACGTGGAAGTGGCCTCTCGCGGCCGGGAATGTGTC
TCGGGGACGCCCGAGTGTGGGAATCGGCTCGGGAGTGCGGGCTTCGGGGCTCTCTGCTTGGAACTCAGA
GGCGCTGACCCAGCCTGGGGCCCGTTTGCTGCCCACGGGAGGAGCCGCCGTCAGGGCTCGAGATTTCTG
TGGCTCCTCAAGATATTGGTCATAATCCTGGTACTTGGCATTGTTGGATTTATGTTCGGAAGCATGTTC
CTTCAAGCAGTGTTCAGCAGCCCCAAGCCAGAACTCCCAAGTCCTGCCCCGGGTGTCCAGAAGCTGAAG
CTTCTGCCTGAGGAACGTCTCAGGAACCTCTTTTCCTACGATGGAATCTGGCTGTTCCCGAAAAATCAG
TGCAAATGTGAAGCCAACAAAGAGCAGGGAGGTTACAACTTTCAGGATGCCTATGGCCAGAGCGACCTC
CCAGCGGTGAAAGCGAGGAGACAGGCTGAATTTGAACACTTTCAGAGGAGAGAAGGGCTGCCCCGCCCA
CTGCCCCTGCTGGTCCAGCCCAACCTCCCCTTTGGGTACCCAGTCCACGGAGTGGAGGTGATGCCCCTG
CACACGGTTCCCATCCCAGGCCTCCAGTTTGAAGGACCCGATGCCCCCGTCTATGAGGTCACCCTGACA
GCTTCTCTGGGGACACTGAACACCCTTGCTGATGTCCCAGACAGTGTGGTGCAGGGCAGAGGCCAGAAG
CAGCTGATCATTTCTACCAGTGACCGGAAGCTGTTGAAGTTCATTCTTCAGCACGTGACATACACCAGC
ACGGGGTACCAGCACCAGAAGGTAGACATAGTGAGTCTGGAGTCCAGGTCCTCAGTGGCCAAGTTTCCA
GTGACCATCCGCCATCCTGTCATACCCAAGCTATACGACCCTGGACCAGAGAGGAAGCTCAGAAACCTG
GTTACCATTGCTACCAAGACTTTCCTCCGCCCCCACAAGCTCATGATCATGCTCCGGAGTATTCGAGAG
TATTACCCAGACTTGACCGTAATAGTGGCTGATGACAGCCAGAAGCCCCTGGAAATTAAAGACAATCAC
GTGGAGTATTACACTATGCCCTTTGGGAAGGGTTGGTTTGCTGGTAGGAACCTGGCCATATCTCAGGTC
ACCACCAAATACGTTCTCTGGGTGGACGATGATTTTCTCTTCAACGAGGAGACCAAGATTGAGGTGCTG
GTGGATGTCCTGGAGAAAACAGAACTGGACGTGGTAGGCGGCAGTGTGCTGGGAAATGTGTTCCAGTTT
AAGTTGTTGCTGGAACAGAGTGAGAATGGGGCCTGCCTTCACAAGAGGATGGGATTTTTCCAACCCCTG
GATGGCTTCCCCAGCTGCGTGGTGACCAGTGGCGTGGTCAACTTCTTCCTGGCCCACACGGAGCGACTC
CAAAGAGTTGGCTTTGATCCCCGCCTGCAACGAGTGGCTCACTCAGAATTCTTCATTGATGGGCTAGGG
ACCCTACTCGTGGGGTCATGCCCAGAAGTGATTATAGGTCACCAGTCTCGGTCTCCAGTGGTGGACTCA
GAACTGGCTGCCCTAGAGAAGACCTACAATACATACCGGTCCAACACCCTCACCCGGGTCCAGTTCAAG
CTGGCCCTCCACTACTTCAAGAACCATCTCCAATGTGCCGCATAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_153446
Insert Size 1701 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_153446.2
RefSeq Size 2021 bp
RefSeq ORF 1701 bp
Locus ID 124872
UniProt ID Q8NHY0
Cytogenetics 17q21.32
Protein Families Transmembrane
MW 63.3 kDa
Summary B4GALNT2 catalyzes the last step in the biosynthesis of the human Sd(a) antigen through the addition of an N-acetylgalactosamine residue via a beta-1,4 linkage to a subterminal galactose residue substituted with an alpha-2,3-linked sialic acid. B4GALNT2 also catalyzes the last step in the biosynthesis of the Cad antigen (Montiel et al., 2003 PubMed 12678917).supplied by OMIM, Mar 2008
Transcript Variant: This variant (1) encodes the longest isoform (a).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_153446" in other vectors (6)
SKU Description Size Price
RC213266 B4GALNT2 (Myc-DDK-tagged)-Human beta-1,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2), transcript variant 1 10 ug
$790.00
RC213266L1 Lenti ORF clone of Human beta-1,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2), transcript variant 1, Myc-DDK-tagged 10 ug
$1,090.00
RC213266L2 Lenti ORF clone of Human beta-1,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2), transcript variant 1, mGFP tagged 10 ug
$1,090.00
RC213266L3 Lenti ORF clone of Human beta-1,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2), transcript variant 1, Myc-DDK-tagged 10 ug
$1,090.00
RC213266L4 Lenti ORF clone of Human beta-1,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2), transcript variant 1, mGFP tagged 10 ug
$1,090.00
RG213266 B4GALNT2 (tGFP-tagged) - Human beta-1,4-N-acetyl-galactosaminyl transferase 2 (B4GALNT2), transcript variant 1 10 ug
$990.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products