OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MPIG6B (NM_138277) Human Untagged Clone

Be the first to review this product
SKU
SC305996
C6orf25 (untagged)-Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 7
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA339555 Rabbit Polyclonal Anti-C6orf25 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MPIG6B or NM_138277"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MPIG6B
Synonyms C6orf25; G6b; G6b-B; NG31; THAMY
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC305996 representing NM_138277.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGTGTTTCTGCAGCTGCTACCGCTGCTGCTCTCGAGGGCCCAAGGGAACCCTGGGGCTTCTCTG
GACGGCCGCCCTGGGGACCGGGTGAATCTCTCCTGCGGAGGAGTCTCTCATCCCATCCGCTGGGTCTGG
GCACCCAGCTTCCCGGCCTGCAAGGGCCTGTCCAAAGGACGCCGACCGATCCTGTGGGCCTCTTCGAGC
GGGACCCCCACCGTGCCTCCCCTCCAGCCTTTCGTCGGCCGCCTACGCTCCCTGGACTCTGGTATCCGG
CGGCTGGAGCTCCTCTTGAGCGCGGGGGACTCGGGCACTTTTTTCTGCAAGGGCCGCCACGAGGACGAG
AGCCGTACAGTGCTTCACGTGCTGGGGGACAGGACCTATTGCAAGGCCCCCGGGCCTACCCATGGGTCC
GTGTATCCCCAGCTCCTGATCCCGCTGCTGGGCGCTGGGTTGGTGCTCGGACTGGGAGCTTTGGGCCTG
GTCTGGTGGCTGCACAGGCGCCTGCCCCCGCAACCGATTCGACCACTCCCTAGATTTGCTCTGTCCCCC
CCACATAGCTCCACTTGTGAAAACCGAGCCCCAGAGGCCAGTAAAGGAGGAAGAGCCCAAGATTCCAGG
GGACCTGGACCAGGAACCGGTAAGGGCATGGGGATGGGAAGGGGATAG
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_138277
Insert Size 669 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138277.2
RefSeq Size 2560 bp
RefSeq ORF 669 bp
Locus ID 80739
UniProt ID O95866
Cytogenetics 6p21.33
Protein Families Druggable Genome, Transmembrane
MW 23.6 kDa
Summary This gene is a member of the immunoglobulin (Ig) superfamily and is located in the major histocompatibility complex (MHC) class III region. The protein encoded by this gene is a glycosylated, plasma membrane-bound cell surface receptor, but soluble isoforms encoded by some transcript variants have been found in the endoplasmic reticulum and Golgi before being secreted. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (7) retains the intervening sequence between coding exons 5 and 6 as compared to transcript variant 1. As a result, variant 7 encodes an isoform (G6b-G), which has a different C-terminus than isoform G6b-A. Isoform G6b-G is a transmembrane protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_138277" in other vectors (6)
SKU Description Size Price
RC222783 C6orf25 (Myc-DDK-tagged)-Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 7 10 ug
$300.00
RC222783L1 Lenti ORF clone of Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 7, Myc-DDK-tagged 10 ug
$600.00
RC222783L2 Lenti ORF clone of Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 7, mGFP tagged 10 ug
$600.00
RC222783L3 Lenti ORF clone of Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 7, Myc-DDK-tagged 10 ug
$600.00
RC222783L4 Lenti ORF clone of Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 7, mGFP tagged 10 ug
$600.00
RG222783 C6orf25 (tGFP-tagged) - Human chromosome 6 open reading frame 25 (C6orf25), transcript variant 7 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products