OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CREB3L3 (NM_032607) Human Untagged Clone

Be the first to review this product
SKU
SC305489
CREB3L3 (untagged)-Human cAMP responsive element binding protein 3-like 3 (CREB3L3)
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CREB3L3 or NM_032607"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CREB3L3
Synonyms CREB-H; CREBH; HYST1481; HYTG2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_032607, the custom clone sequence may differ by one or more nucleotides
ATGAATACGGATTTAGCTGCTGGAAAGATGGCTTCTGCTGCCTGCTCCATGGACCCCATC
GACAGCTTTGAGCTCCTGGATCTCCTGTTTGACCGGCAGGACGGCATCCTGAGACACGTG
GAGCTGGGCGAGGGCTGGGGTCACGTCAAGGACCAGCAGGTCCTGCCAAACCCCGACTCT
GACGACTTCCTCAGCTCCATCCTGGGCTCTGGAGACTCACTGCCCAGCTCCCCACTCTGG
TCCCCCGAAGGCAGTGATAGTGGCATCTCCGAAGACCTCCCCTCCGACCCCCAGGACACC
CCTCCACGCAGCGGACCAGCCACCTCCCCCGCCGGCTGCCATCCTGCCCAGCCTGGCAAG
GGGCCCTGCCTCTCCTATCATCCTGGCAACTCTTGCTCCACCACAACCCCAGGGCCAGTG
ATCCAAGTACCTGAAGCCTCTGTGACCATAGACCTGGAAATGTGGAGCCCAGGAGGAAGG
ATCTGTGCTGAGAAGCCGGCTGATCCGGTGGACCTGTCCCCACGATGCAATCTCACCGTG
AAAGACCTCCTCCTTTCGGGCAGCAGTGGGGACCTGCAACAGCATCACCTGGGGGCCTCC
TACCTCCTGCGACCTGGGGCTGGGCACTGTCAGGAGCTGGTGCTCACCGAGGATGAGAAG
AAGCTGCTGGCTAAAGAAGGCATCACCCTGCCCACTCAGCTGCCCCTCACTAAGTACGAG
GAGCGAGTGCTGAAAAAAATCCGCCGGAAAATCCGGAACAAGCAGTCGGCGCAAGAAAGC
AGGAAGAAGAAGAAGGAATATATCGATGGCCTGGAGACTCGGATGTCAGCTTGCACTGCT
CAGAATCAGGAGTTACAGAGGAAAGTCTTGCATCTCGAGAAGCAAAACCTGTCCCTCTTG
GAGCAACTGAAGAAACTCCAGGCCATTGTGGTGCAGTCCACCAGCAAGTCAGCCCAGACA
GGCACCTGTGTCGCAGTCCTGTTGCTGTCCTTTGCCCTCATCATCCTCCCCTCCATCAGC
CCTTTTGGCCCCAACAAAACCGAGAGCCCTGGGGACTTTGCGCCTGTACGAGTGTTCTCC
AGAACTTTGCACAACGATGCTGCCTCCCGCGTGGCTGCTGATGCTGTGCCAGGCTCCGAG
GCCCCAGGACCCCGACCCGAGGCTGACACAACCCGAGAAGAGTCTCCAGGAAGCCCCGGG
GCAGACTGGGGCTTCCAGGACACCGCGAACCTGACCAATTCGACGGAGGAGCTGGACAAC
GCCACCCTGGTCCTGAGGAATGCAACAGAGGGGCTGGGCCAGGTCGCCCTGCTGGACTGG
GTGGCGCCTGGGCCGAGCACTGGCTCAGGACGTGCAGGGCTGGAGGCGGCGGGAGACGAG
CTGTGA
Restriction Sites Please inquire |
ACCN NM_032607
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032607.1, NP_115996.1
RefSeq Size 2586 bp
RefSeq ORF 1386 bp
Locus ID 84699
UniProt ID Q68CJ9
Cytogenetics 19p13.3
Protein Families Transcription Factors
Protein Pathways Huntington's disease, Melanogenesis, Prostate cancer
Summary This gene encodes a member of the basic-leucine zipper family and the AMP-dependent transcription factor family. The encoded protein is localized to the endoplasmic reticulum and acts as a transcription factor activated by cyclic AMP stimulation. The encoded protein binds the cyclic AMP response element (CRE) and the box-B element and has been linked to acute inflammatory response, hepatocellular carcinoma, triglyceride metabolism, and hepcidin expression. Alternative splicing results in multiple transcript variants. provided by RefSeq, Dec 2012
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_032607" in other vectors (6)
SKU Description Size Price
RC210921 CREB3L3 (Myc-DDK-tagged)-Human cAMP responsive element binding protein 3-like 3 (CREB3L3) 10 ug
$457.00
RC210921L1 Lenti ORF clone of Human cAMP responsive element binding protein 3-like 3 (CREB3L3), Myc-DDK-tagged 10 ug
$757.00
RC210921L2 Lenti ORF clone of Human cAMP responsive element binding protein 3-like 3 (CREB3L3), mGFP tagged 10 ug
$757.00
RC210921L3 Lenti ORF clone of Human cAMP responsive element binding protein 3-like 3 (CREB3L3), Myc-DDK-tagged 10 ug
$757.00
RC210921L4 Lenti ORF clone of Human cAMP responsive element binding protein 3-like 3 (CREB3L3), mGFP tagged 10 ug
$757.00
RG210921 CREB3L3 (tGFP-tagged) - Human cAMP responsive element binding protein 3-like 3 (CREB3L3) 10 ug
$489.00 $657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products